Ч 4 ст 122 тк рф: ТК РФ Статья 122. Порядок предоставления ежегодных оплачиваемых отпусков

Содержание

Ст. 122 ТК РФ с Комментариями 2020-2021 года (новая редакция с последними изменениями)

Оплачиваемый отпуск должен предоставляться работнику ежегодно.

Право на использование отпуска за первый год работы возникает у работника по истечении шести месяцев его непрерывной работы у данного работодателя. По соглашению сторон оплачиваемый отпуск работнику может быть предоставлен и до истечения шести месяцев.

До истечения шести месяцев непрерывной работы оплачиваемый отпуск по заявлению работника должен быть предоставлен:

женщинам — перед отпуском по беременности и родам или непосредственно после него;

работникам в возрасте до восемнадцати лет;

работникам, усыновившим ребенка (детей) в возрасте до трех месяцев;

в других случаях, предусмотренных федеральными законами.

Отпуск за второй и последующие годы работы может предоставляться в любое время рабочего года в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков, установленной у данного работодателя.

Комментарий к Ст. 122 ТК РФ

1. Право на использование оплачиваемого отпуска за первый год работы возникает у работника по истечении шести месяцев непрерывной работы у данного работодателя, с возможностью предоставления отпуска по соглашению сторон и до истечения указанного периода времени.

Бесплатная юридическая консультация по телефонам:

2. Для некоторых категорий работников (например, женщин в связи с беременностью и родами — см. комментарий к ст. 260 ТК РФ), определяемых ТК РФ. иными федеральными законами, установлено право на досрочное использование отпуска, т.е. авансом.

3. Оплачиваемый отпуск в последующие годы работы может предоставляться работникам в любое время рабочего года с соблюдением требований ст. 123 ТК (см. комментарий к данной статье).

Второй комментарий к Статье 122 Трудового кодекса

1. Изменение редакционного характера коснулось ч. 2 ст. 122. Слова «в данной организации» заменены словами «у данного работодателя». В результате положения данной статьи распространяются на всех работодателей — юридических и физических лиц.

2. Конституция РФ (ч. 5 ст. 37) гарантирует предоставление работникам оплачиваемого ежегодного отпуска.

В соответствии с этим Кодекс именует отпуска, предоставляемые за работу, ежегодными оплачиваемыми отпусками и устанавливает, по сути, обязанность работодателя предоставлять работникам оплачиваемый отпуск ежегодно.

При этом, естественно, имеется в виду не календарный год (с 1 января по 31 декабря), а рабочий год, определяемый для каждого работника индивидуально с даты его поступления на работу (например, с 7 января 2004 г. по 6 января 2005 г.).

3. Перенесение ежегодного оплачиваемого отпуска с текущего рабочего года на следующий рабочий год Кодекс допускает в порядке исключения с соблюдением определенного порядка (см. ч. 3 ст. 124 ТК РФ).

4. КЗоТ 1971 г. (ч. 1 ст. 71) предусматривал предоставление ежегодного оплачиваемого отпуска в первом рабочем году, как правило, по истечении 11 месяцев непрерывной работы на данном предприятии, в учреждении, организации.

Трудовой кодекс сокращает этот срок до 6 месяцев. Возможность предоставления ежегодного оплачиваемого отпуска до истечения этого срока Кодекс не рассматривает в качестве исключения. Статья 122 ТК РФ разрешает это при условии достижения соглашения между сторонами трудового договора.

Кроме того, Кодекс закрепляет право работника (и соответствующую обязанность работодателя) на досрочное предоставление ежегодного оплачиваемого отпуска для определенных категорий работников (см. ч. 3 ст. 122).

5. Ежегодный оплачиваемый отпуск должен предоставляться работнику полностью за рабочий год независимо от того, проработал работник в организации непрерывно 6 месяцев или нет. При этом необходимо иметь в виду возможность разделения отпуска на части по соглашению между работником и работодателем (см. ч. 1 ст. 125 ТК РФ).

6. Предоставление ежегодного оплачиваемого отпуска пропорционально проработанному времени Кодексом не предусмотрено.

7. Предоставляемый в соответствии со ст. 122 ТК РФ отпуск оплачивается полностью за все дни отпуска, которые работнику предстоит использовать.

8. Однако, поскольку дополнительные оплачиваемые отпуска за работу во вредных и (или) опасных условиях предоставляются за время, фактически проработанное в этих условиях (см. ч. 3 ст. 121), в первом рабочем году этот отпуск предоставляется пропорционально проработанному в этих условиях трудовому стажу. Предоставление отпуска за работу во вредных и (или) опасных условиях авансом действующими нормами трудового законодательства не предусмотрено.

Статья 122 Трудового Кодекса РФ с комментариями

Оплачиваемый отпуск должен предоставляться работнику ежегодно.

Право на использование отпуска за первый год работы возникает у работника по истечении шести месяцев его непрерывной работы у данного работодателя. По соглашению сторон оплачиваемый отпуск работнику может быть предоставлен и до истечения шести месяцев .
До истечения шести месяцев непрерывной работы оплачиваемый отпуск по заявлению работника должен быть предоставлен:

женщинам — перед отпуском по беременности и родам или непосредственно после него;
работникам в возрасте до восемнадцати лет;
работникам, усыновившим ребенка (детей) в возрасте до трех месяцев;
в других случаях, предусмотренных федеральными законами.

Отпуск за второй и последующие годы работы может предоставляться в любое время рабочего года в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков, установленной у данного работодателя .

Комментарий к статье 122 ТК РФ

Часть 1 комментируемой статьи направлена на реальное предоставление работникам оплачиваемых отпусков ежегодно.

Право на использование отпуска за первый год работы возникает у работника, в отличие от ранее действовавшего КЗоТа, не через 11 месяцев, а по истечении шести месяцев непрерывной работы в данной организации (у работодателя). Ежегодный оплачиваемый отпуск предоставляется работникам за каждый рабочий год.

Первый рабочий год работника исчисляется со дня поступления на работу к данному работодателю, а последующие — со дня, следующего за днем окончания предыдущего рабочего года. Например, работник принят на работу 15 апреля 2005 г. В этом случае рабочий год у него завершается 15 апреля 2006 г. Именно за этот период ему предоставляется отпуск установленной продолжительности.

До истечения шести месяцев непрерывной работы в первый год работнику может быть предоставлен оплачиваемый отпуск по соглашению сторон.

Работодатель до истечения шести месяцев должен предоставить оплачиваемый отпуск по заявлению работника в следующих случаях: женщинам — перед отпуском по беременности и родам или непосредственно после него; работникам в возрасте до 18 лет; работникам, усыновившим ребенка в возрасте до трех месяцев, и в других случаях, предусмотренных федеральными законами. В период нахождения жены в отпуске по беременности и родам мужу, по его желанию, ежегодный оплачиваемый отпуск должен предоставляться независимо от времени его непрерывной работы у данного работодателя (см. ч. 4 ст. 123 ТК).

Для предоставления ежегодного оплачиваемого отпуска в последующие годы работы имеет значение очередность предоставления таких отпусков, установленная работодателем (см. коммент. к ст. 123).

Другой комментарий к статье 122 ТК РФ

По общему правилу право на предоставление ежегодного оплачиваемого отпуска возникает у работника по истечении 6 месяцев непрерывной работы у данного работодателя, однако по соглашению между работником и работодателем отпуск может быть предоставлен и до истечения этого срока.

Вместе с тем в комментируемой статье названы категории работников, которым работодатель обязан предоставить ежегодный оплачиваемый отпуск до истечения 6 месяцев непрерывной работы:
— женщины — перед отпуском по беременности и родам или непосредственно после него;
— работники в возрасте до 18 лет;
— работники, усыновившие ребенка (детей) в возрасте до 3 месяцев.

Имеются и другие случаи, когда работодатель обязан предоставить отпуск работникам, не отработавшим 6 месяцев, например, лицам, работающим по совместительству (ст.286 ТК РФ).

Данные правила касаются первого года работы работника у конкретного работодателя. За второй и последующие годы работы отпуск предоставляется в любое время года в соответствии с графиком отпусков (см. комментарий к ст.123).

В качестве примера из судебной практики приведем определение Санкт-Петербургского городского суда N 33-16777/2012, в котором отмечается, что законодательство не предусматривает предоставление отпуска раньше, чем начнется рабочий год, за который он предоставляется. Если на момент подачи заявления о предоставлении отпуска у работника не возникло права на ежегодный оплачиваемый отпуск в указанном количестве дней, что послужило причиной отказа в его предоставлении, однако сотрудник самовольно ушел в отпуск, то признается законным приказ работодателя об увольнении работника в соответствии с пп.»а» п.6 ч.1 ст.81 ТК РФ.

Статья 122 ТК РФ 2016-2019. Порядок предоставления ежегодных оплачиваемых отпусков. ЮрИнспекция

«..Расчет компенсации за неиспользованный отпуск Требования Трудового кодекса в части предоставления отпусков работникам Статьей 122 ТК РФ определена обязанность работодателя по ежегодному предоставлению работнику оплачиваемого отпуска продолжительность 28 календарных дней (ст. 115 ТК РФ) [1]. Перенос отпуска на следующий год допускается (по соглашению сторон) только в исключительных случаях (в частности, когда уход работника в отпуск в текущем году может негативно отразиться на деятельности организации) . При этом дни перенесенного отпуска работник должен использовать не позднее 12 месяцев после окончания того рабочего года, за который предоставляется отпуск. Работодателю запрещено не предоставлять работнику ежегодный оплачиваемый отпуск в течение двух лет подряд (ст. 124 НК РФ) . При этом сотрудникам в возрасте до 18 лет, а также тем, кто занят на работах с вредными и (или) опасными условиями труда, он обязан предоставлять отпуск ежегодно. Таким образом, законодательством установлены строгие ограничения для работодателей в части предоставления отпусков работникам. Тем не менее на практике у работников нередко накапливаются неиспользованные отпуска за предыдущие годы. В этом случае за работодателем сохраняется обязанность предоставить сотруднику эти отпуска либо выплатить ему денежную компенсацию за их неиспользованные дни. В каких случаях выплачивается денежная компенсация за неиспользованный отпуск? Денежная компенсация за неиспользованный отпуск выплачивается при увольнении (ст. 127 ТК РФ) , а также по письменному заявлению работника за часть отпуска, превышающую 28 календарных дней (ст. 126 ТК РФ) . Следует также учитывать, что замена отпуска денежной компенсацией не допускается: беременным женщинам; работникам в возрасте до восемнадцати лет; работникам, занятым на тяжелых работах и работах с вредными и (или) опасными условиями труда. Расчет компенсации за неиспользованный отпуск Сумма компенсации за неиспользованный отпуск при увольнении (в том числе для организаций, применяющих суммированный учет рабочего времени) рассчитывается следующим образом: Компенсация за неиспользованный отпуск при увольнении = Средний дневной (часовой) заработок за расчетный период х Количество дней (часов) отпуска, не использованных за время работы в организации Расчет среднего дневного (часового) заработка для выплаты компенсации за неиспользованный отпуск производится по правилам, установленным ст. 139 ТК РФ и Положением об исчислении средней заработной платы [2], и исчисляется за последние три календарных месяца (если иной расчетный период не предусмотрен коллективным договором) [3] путем деления суммы фактически начисленной заработной платы на расчетное количество дней (фактически отработанных часов) за расчетный период. При увольнении.. . Самый распространенный случай, когда за неиспользованный отпуск выдается денежная компенсация, — это увольнение работника. Отметим, что при увольнении работнику по его заявлению могут быть предоставлены все не использованные им отпуска (и основной, и дополнительный) , за исключением случая, если его увольнение связано с виновными действиями. Днем увольнения работника будет считаться последний день его отпуска. В этом случае оплачивается предоставленный работнику отпуск, и, соответственно, компенсация за неиспользованный отпуск при увольнении не выплачивается… «

Государственная инспекция труда в Мурманской области

Вопрос: Сейчас в организации согласуется график отпусков на следующий год. В соответствии со своим рабочим годом я распределил на 2021 год 30 дней отпуска (18 дней из текущего периода и 12 — из следующего). Отдел кадров отказывается согласовывать такой вариант, ссылаясь на «ежегодность» отпуска. То есть всех работников заставляют распределять четко положенное им по законодательству количество дней отпуска в течение календарного года без возможности переноса на следующий год. Таким образом, если я, к примеру, устроился в июне и взял в свой первый рабочий год 10 дней отпуска, то в следующем году мне придется с июня по декабрь использовать ровно столько же дней отпуска. Считаю это грубым нарушением своих прав на отдых. Прошу дать разъяснения по этому вопросу.

 

Ответ: Если вы устроились в июне 2020 г., то воспользоваться ежегодным оплачиваемым отпуском за период работы с июня 2020 г. по июнь 2021 вам следует до июня 2021 г. Начиная с июня 2021 г. вы будете иметь право на использование ежегодного оплачиваемого отпуска в полном размере за период с июня 2021 г. по июнь 2022 г.

Разделение ежегодного оплачиваемого отпуска возможно только по взаимному согласию работника и работодателя, а не по указанию какой-либо из сторон трудового договора.

Если работник и работодатель не могут прийти к соглашению о разделении ежегодного оплачиваемого отпуска на части, то такой отпуск должен быть предоставлен целиком (неделимой частью).

Дополнительно сообщаем, что при составлении графика отпусков работодатель обязан учитывать мнение работников.

 

Правовое обоснование: Согласно ч. 1 ст. 122 ТК РФ оплачиваемый отпуск должен предоставляться работнику ежегодно.

Отпуск за второй и последующие годы работы может предоставляться в любое время рабочего года в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков, установленной у данного работодателя (ч. 4 ст. 122 ТК РФ).

Согласно ч. 1 ст. 125 ТК РФ по соглашению между работником и работодателем ежегодный оплачиваемый отпуск может быть разделен на части. При этом хотя бы одна из частей этого отпуска должна быть не менее 14 календарных дней.

В соответствии со ст. 115 ТК РФ ежегодный основной оплачиваемый отпуск предоставляется работникам продолжительностью 28 календарных дней.

Ежегодный основной оплачиваемый отпуск продолжительностью более 28 календарных дней (удлиненный основной отпуск) предоставляется работникам в соответствии с ТК РФ и иными федеральными законами.

В соответствии с ч. 1 ст. 123 ТК РФ очередность предоставления оплачиваемых отпусков определяется ежегодно в соответствии с графиком отпусков, утверждаемым работодателем с учетом мнения выборного органа первичной профсоюзной организации не позднее чем за две недели до наступления календарного года в порядке, установленном ст. 372 ТК РФ для принятия локальных нормативных актов.

График отпусков обязателен как для работодателя, так и для работника (ч. 2 ст. 123 ТК РФ).

 

Статья 122 ТК РФ. Порядок предоставления ежегодных оплачиваемых отпусков

Часто при устройстве на работу, многие задаются вопросом — когда положен отпуск? В нашей статье мы расскажем, полагается ли новым работникам отпуск, когда его можно получить и как это сделать.

Не все знают, но в первый год работы каждый имеет право на отпуск. Обязанностью работодателя является его предоставление. Делается это несмотря на то, что отпуск не будет закреплен в графике. Однако, имеются и определенные ограничения на его получение, чтобы не было проблем с компенсацией в случае увольнения.

Продолжительность отпуска

Продолжительность основного ежегодного отпуска, предоставляемого работнику, не может составлять менее 28 календарных дней. В данный период не включаются праздничные дни.

Минимальная длительность ежегодного отпуска не зависит от установленного для работника режима рабочего времени (нормальное, неполное или сокращенное). Отметим, однако, что для отдельных работников Трудовым кодексом и федеральным законодательством установлен особый, удлиненный ежегодный отпуск. Так:

  • продолжительность минимального отпуска для несовершеннолетних работников равна 31 дню;
  • ежегодный отпуск для работников-инвалидов не может длиться менее 30 дней;
  • минимальная продолжительность отпуска для работников детских учреждений составляет 43 дня;
  • работники учреждений образования и педагоги имеют право на ежегодный отпуск минимальной продолжительностью от 42 до 56 дней;
  • следователям прокуратуры и прокурорам гарантирован ежегодный отпуск длительностью не менее 30 дней.

Во всех указанных выше случаях продолжительность отпуска указана в календарных днях.



Статья 122 ТК РФ. Порядок предоставления ежегодных оплачиваемых отпусков

1. Ежегодный оплачиваемый отпуск предоставляется работникам за каждый их рабочий год. Рабочий год составляет 12 месяцев и в отличие от календарного года исчисляется не с 1 января, а с даты поступления на работу. Так, если работник поступил на работу 1 февраля 2008 г., то его первый рабочий год истекает 31 января 2009 г., второй рабочий год — это период с 1 февраля 2009 г. до 1 февраля 2010 г. и т.д. Если какие-либо периоды времени в соответствии с ч. 2 ст. 121 ТК не включаются в стаж работы для отпуска (см. коммент. к ней), то окончание рабочего года отодвигается на число дней отсутствия работника, исключенных из стажа работы для отпуска.

Закон предусматривает различный порядок предоставления отпуска в зависимости от того, за какой рабочий год он полагается — первый или последующие.

2. Ст 122 ТК РФ гласит, что ежегодный оплачиваемый отпуск за первый год работы предоставляется по истечении 6 месяцев непрерывной работы у данного работодателя. Следовательно, по общему правилу тем, кто трудится у данного работодателя первый год, отпуск должен предоставляться на 7-м месяце работы, если в течение 6-месячного периода у них не было перерывов в работе, которые в соответствии с ч. 2 ст. 121 ТК не включаются в стаж, дающий право на ежегодный основной оплачиваемый отпуск.

Стаж для получения ежегодного отпуска должен быть непрерывным. Это означает, что отпуск предоставляется только за время работы у данного работодателя. Поэтому, когда работник увольняется, он должен полностью закончить свои расчеты по отпуску, получив денежную компенсацию за неиспользованные дни отпуска.

Правило ч. 2 комментируемой статьи нельзя рассматривать как запрет на предоставление отпуска в первый год работы до истечения 6 месяцев. По взаимной договоренности между работником и работодателем оплачиваемый отпуск и в первый рабочий год может быть предоставлен авансом. Иногда же это просто необходимо. Например, когда на работу одновременно принимается большое число работников.

3. В случаях, предусмотренных ч. 3 статьи 122 ТК РФ, работодатель обязан по заявлению работника предоставить ему отпуск на первом году работы до истечения 6 месяцев. Причем какой-либо минимальной продолжительности работы в данной организации закон здесь не устанавливает. Поэтому, например, если женщине, проработавшей в организации 1 месяц, предоставлен отпуск по беременности и родам, она вправе потребовать предоставления ежегодного оплачиваемого отпуска непосредственно после окончания этого отпуска.

До истечения 6 месяцев, т.е. авансом, ежегодный оплачиваемый отпуск может быть предоставлен и в других случаях, предусмотренных ТК или иным федеральным законом. Например, мужу — в период нахождения его жены в отпуске по беременности и родам (ч. 4 ст. 123 ТК РФ), работникам, которые в соответствии с федеральными законами имеют право на предоставление им ежегодного оплачиваемого отпуска по их желанию в удобное для них время, а следовательно, и авансом (см. коммент. к ст. 123).

4. Согласно ст 122 ТК РФ, отпуск за второй и последующий годы работы может предоставляться в любое время рабочего года, в т.ч. и до наступления права на получение отпуска, т.е. авансом, в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков (см. комментарий к ст. 123 ТК).

5. Действующее законодательство не предусматривает предоставления в натуре неполного ежегодного основного оплачиваемого отпуска, т.е. пропорционально отработанному в данном рабочем году времени. Поэтому, если ежегодный основной отпуск предоставляется в первый год авансом (до истечения 6 месяцев непрерывной работы у данного работодателя), он должен быть полным, т.е. установленной продолжительности, при условии, что работник не просит предоставить ему только часть отпуска.

Предоставление отпуска

Предоставляться отпуск работнику должен до истечения текущего рабочего года. Если имеются причины, по которым отпуск не может быть предоставлен в оговоренный графиком отпуска срок, то новая дата отпуска должна быть определена по соглашению с работником.

Отказ от предоставления отпуска в течение двух лет подряд запрещается.

Если трудовой договор с работником был заключен на срок менее 2 месяцев, то вместо отпуска при увольнении может быть предоставлена компенсация. Размер ее рассчитывается следующим образом: два рабочих дня за один месяц работы.

Отпуск в первый год работы: права работника


Отпуск в первый год работы
При поступлении на новое рабочее место каждый сотрудник сразу хочет знать, когда ему положен отпуск, чтобы распланировать время отдыха. Этот вопрос можно сразу же обсудить с работодателем и уточнить конкретную дату. Однако, тут надо понимать, что отдых предоставляется не за полный год работы, а начинает отсчитываться от даты трудоустройства. Так что для всех сотрудников ведутся индивидуальные отчеты.

Впервые отправиться в отпуск работник может уже через 6 месяцев после начала работы. Это оговаривается в ТК РФ статьей 122. Причем можно претендовать на полный отпуск вместе с дополнительными днями, которые положены по договору.

Разделение и перенос отпуска

Допускается предоставление отпуска по частям. Разделение отпуска производится по соглашению между работником и работодателем, причем хотя бы одна из частей отпуска должна иметь продолжительность не менее 14 календарных дней (статья 125 ТК РФ).

Также по соглашению между сторонами трудового договора отпуск может быть перенесен в случаях, если:

  • работник не был предупрежден о начале отпуска в двухнедельный срок до его начала;
  • работнику своевременно не были выплачены отпускные.

Кто имеет право на досрочный отпуск за первый год работы?

Некоторый категории работников поучают право на первый отпуск до истечения 6 месяцев работы. К ним относятся:

  • Женщины перед отпуском по беременности и родам либо сразу после него,
  • Работники в возрасте до 18 лет,
  • Работники, усыновившие ребенка в возрасте до трех месяцев
  • Иным категориям сотрудников, установленным федеральными законами (ст. 122 ТК РФ).

Отказать им в представлении отпуска по причине не отработки требуемого срока работодатель не может.

Оплата отпуска

Не позднее чем за три дня до начала отпуска работнику должны быть выплачены отпускные. Сумма отпускных облагается НДФЛ, единым социальным налогом, взносами на обязательное пенсионное страхование и на страхование от несчастных случаев и профессиональных заболеваний в общем порядке. Порядок расчета отпускных оговорен статьей 139 ТК РФ.

Если отпуск был предоставлен работнику авансом и имело место увольнение работника до истечения года, в счет которого он получил этот отпуск, то отпускные, выплаченные этому работнику, удерживаются из его заработной платы.

Удержание не производится, если работник:

  • уволен в связи с отказом от перевода по состоянию здоровья (на основе медзаключения) или в связи с тем, что у работодателя отсутствует возможность предоставить такому работнику соответствующее требованиям, оговоренным медзаключением, место;
  • уволен в связи с сокращением штата или ликвидацией организации или ИП;
  • является руководителем, его заместителем или главным бухгалтером, которые уволены по причине смены собственника имущества организации;
  • уволен в связи с призывом на военслужбу или направлен на альтернативную гражданскую службу;
  • был уволен ранее и восстановлен по решению ГТИ или суда;
  • признается полностью нетрудоспособным на основании медицинского заключения;
  • умер или признан судом умершим или безвестно отсутствующим;
  • уволен в связи со смертью работодателя, а также в связи с признанием работодателя судом умершим или безвестно отсутствующим;
  • не может продолжать трудовую деятельность в связи с наступившими чрезвычайными обстоятельствами.

Как получить отпуск за первый год работы

Чтобы получить право использовать отпуск за первый год работы сотруднику нужно написать заявление о предоставлении отпуска на имя руководителя предприятия или ИП. Ведь того, кто берет отпуск на этом месте работы впервые, в графике отпусков, скорее всего, не окажется. Срок и форма подачи заявления о предоставлении отпуска официально не установлены, поэтому каждому предприятию нужно утверждать их самостоятельно, внутренними нормативными актами. На основании этого заявления издается приказ о предоставлении отпуска и составляется записка – расчет о начислении отпускных.

График отпусков: когда положен отпуск на новой работе

Очередность предоставления персоналу отпусков определяется в соответствии с обязательным для всех работодателей графиком отпусков. Порядок составления этого документа на будущий календарный год определен ст. 123 ТК – не позднее 2 недель до окончания текущего периода.

А что говорит Трудовой кодекс по поводу отпуска через 6 месяцев? Ведь новые сотрудники могут поступить на работу в организацию уже после утверждения руководителем графика. В этом вопросе ни работодатель, ни работник никак не ограничиваются. Поскольку задним числом изменения в график отпусков обычно не вносятся, вновь принятому сотруднику придется написать заявление на первый отдых. В случае согласия директора компании отпуск предоставляется без ограничений, в полном объеме, если стороны заранее не договорились о разделении выходного периода на части.

Обратите внимание! В случае представления отпуска после 6 месяцев работы Трудовой кодекс не запрещает вносить изменения в основной график отпусков при желании работодателя. В этой ситуации кадровые специалисты рекомендуют утвердить дополнительный график с обязательным предварительным согласованием дат отдыха с работниками или профсоюзом предприятия.

Сколько времени продлится досрочный отпуск за первый год

Даже в том случае, если работник использует свое право на отпуск за первый год работы досрочно, он все равно имеет право отгулять этот отпуск в полном размере, в соответствии с нормами, установленными для этой категории работников. Никаких законодательных ограничений здесь нет. Иное дело, опасения работодателя, того что новый сотрудник , получив отпускные в полном размере, может не отработать свой трудовой год до конца или вовсе не вернуться на работу . В этом случае работнику могут предложить отгулять только некоторую часть отпуска.

Доказывать ли свое право на использование отпуска за первый год работы в полном объёме – личное дело каждого работника. Но, поискать компромиссное решение всегда стоит.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Сезон отпусков начинается…

В соответствии со ст. 114 ТК РФ работникам предоставляются ежегодные отпуска с сохранением места работы (должности) и среднего заработка. В силу ч. 1 ст. 122 ТК РФ оплачиваемый отпуск должен предоставляться работнику ежегодно.

Согласно ч. 2 ст. 122 ТК РФ, право на использование отпуска за первый год работы возникает у работника по истечении шести месяцев его непрерывной работы у данного работодателя. По соглашению сторон оплачиваемый отпуск работнику может быть предоставлен и до истечения шести месяцев. Отпуск за второй и последующие годы работы может предоставляться в любое время рабочего года в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков, установленной у данного работодателя (ч. 4 ст. 122 ТК РФ).

Кроме того, в настоящее время в части, не противоречащей ТК РФ, в силу ст. 423 ТК РФ продолжают применяться Правила об очередных и дополнительных отпусках, утв. НКТ СССР 30.04.1930 № 169 (далее — Правила). Пунктом 1 Правил также предусмотрено, что очередной отпуск предоставляется один раз в течение года работы работника у данного нанимателя, считая со дня поступления на работу, т. е. один раз в рабочем году.

Как видно, оплачиваемый отпуск полагается не за календарный, а за рабочий год. Первый рабочий год начинается со дня, когда работник приступил к работе, второй — со дня, следующего за днем окончания первого рабочего года, и т. д. (письмо Роструда от 08.12.2008 № 2742-6-1). В стаж работы, дающий право на ежегодный основной оплачиваемый отпуск, не включаются периоды, указанные в ч. 2 ст.121 ТК РФ (время отсутствия работника на работе без уважительных причин, время отпусков по уходу за ребенком до достижения им установленного законом возраста), поэтому рабочий год удлиняется на число дней таких периодов.

Из приведенных норм также следует, что ежегодный оплачиваемый отпуск за очередной рабочий год должен предоставляться работнику в пределах этого рабочего года.

Согласно ч. 1 ст. 123 ТК РФ, очередность предоставления отпусков определяется работодателем ежегодно в соответствии с графиком отпусков, утверждаемым им с учетом мнения выборного органа первичной профсоюзной организации, не позднее чем за две недели до наступления календарного года в порядке, установленном ст. 372 ТК РФ для принятия локальных нормативных актов. При отсутствии профсоюза график отпусков утверждается работодателем самостоятельно (ч. 2 ст. 8 ТК РФ).

Предоставление отпуска — Юридическая консультация

Вопросы предоставления отпусков регулируются гл. 19 Трудового кодекса РФ.

Согласно ч. 1 ст. 122 ТК РФ оплачиваемый отпуск должен предоставляться работнику ежегодно.

Согласно ч. 2 ст. 122 ТК РФ право на использование отпуска за первый год работы возникает у работника по истечении шести месяцев его непрерывной работы у данного работодателя. По соглашению сторон оплачиваемый отпуск работнику может быть предоставлен и до истечения шести месяцев.

Согласно ч. 4 ст. 122 ТК РФ отпуск за второй и последующие годы работы может предоставляться в любое время рабочего года в соответствии с очередностью предоставления ежегодных оплачиваемых отпусков, установленной у данного работодателя.

Согласно ст. 123 ТК РФ очередность предоставления оплачиваемых отпусков определяется ежегодно в соответствии с графиком отпусков, утверждаемым работодателем с учетом мнения выборного органа первичной профсоюзной организации не позднее чем за две недели до наступления календарного года в порядке, установленном ст. 372 ТК РФ для принятия локальных нормативных актов. График отпусков обязателен как для работодателя, так и для работника. О времени начала отпуска работник должен быть извещен под роспись не позднее чем за две недели до его начала. Отдельным категориям работников в случаях, предусмотренных ТК РФ и иными федеральными, ежегодный оплачиваемый отпуск предоставляется по их желанию в удобное для них время. По желанию мужа ежегодный отпуск ему предоставляется в период нахождения его жены в отпуске по беременности и родам независимо от времени его непрерывной работы у данного работодателя.

Первый с начала работы отпуск мог быть предоставлен в октябре 2017 года. В 2018 году отпуск может быть предоставлен в любое время, но в соответствии с утвержденным графиком в порядке, установленном ст. 123 ТК РФ. Продолжительность отпуска такая же – 28 календарных дней (ст. 115 ТК РФ).

Дополнительные отпуска, перенос отпуска и разделение его на части регулируются другими статьями гл. 19 ТК РФ.

% PDF-1.6 % 879 0 объект > / OCGs [904 0 R] >> / Страницы 855 0 R / Тип / Каталог >> эндобдж 903 0 объект > / Шрифт >>> / Поля 908 0 R >> эндобдж 877 0 объект > поток заявка / pdf

  • jmolnar
  • 2006-04-28T12: 27: 07-04: 00PScript5.dll Версия 5.2.22011-01-11T10: 21: 48-05: 002011-01-11T10: 21: 48-05: 00 Acrobat Distiller 5.0 (Windows) uuid: f2695f3a-2d0f-44c3-a5f4-a49c79edb67auuid: 16751472-b506-41cc-a0b1-9970bd23762f конечный поток эндобдж 855 0 объект > эндобдж 845 0 объект > эндобдж 857 0 объект > эндобдж 868 0 объект > эндобдж 867 0 объект > эндобдж 869 0 объект > эндобдж 870 0 объект > эндобдж 871 0 объект > эндобдж 872 0 объект > эндобдж 873 0 объект > эндобдж 874 0 объект > эндобдж 875 0 объект > эндобдж 808 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / XObject >>> / Rotate 0 / Type / Page >> эндобдж 811 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / XObject >>> / Rotate 0 / Type / Page >> эндобдж 814 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / XObject >>> / Rotate 0 / Type / Page >> эндобдж 817 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / XObject >>> / Rotate 0 / Type / Page >> эндобдж 820 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / XObject >>> / Rotate 0 / Type / Page >> эндобдж 823 0 объект > / XObject >>> / Rotate 0 / Type / Page >> эндобдж 924 0 объект > поток HDA0 TnvaR 貀 Ģ- י l {& Ym ޛ Ydm ޻ D.ٟ, # ߈ ۻ NbfnjgA |} # ʿ

    A Critical Evaluation of Anti-IL-13 and Anti-IL-4 Strategies in Heavy Asthma — FullText — International Archives of Allergy and Immunology 2016, Vol. 170, № 2

    Аннотация

    Астма — это заболевание с высокой распространенностью, которое по-прежнему является причиной смертности и высоких прямых и косвенных затрат. В настоящее время признано, что, несмотря на выполнение руководящих принципов, значительная часть случаев остается неконтролируемой. Конечно, приверженность к терапии и обучение пациентов остаются первоочередной задачей, но все более подробные знания о патогенных механизмах и новых биотехнологиях дают возможность лучше бороться с этим заболеванием и лечить его.Интерлейкин (ИЛ) -13 и ИЛ-4 являются наиболее подходящими мишенями для лечения Т-хелперных 2 (Th3) -опосредованных форм (эндотипов) астмы. IL-13 и IL-4 частично имеют один и тот же рецептор и пути передачи сигналов, и оба глубоко вовлечены в синтез иммуноглобулина E (IgE), активацию эозинофилов, секрецию слизи и ремоделирование дыхательных путей. Было предложено несколько анти-IL-13 стратегий (анрукинзумаб, лебрикизунаб и тралокинумаб) с соответствующими клиническими результатами, полученными при применении лебрикизумаба. Такие исследования способствуют лучшему определению возможных прогностических маркеров ответа на конкретное лечение (например,грамм. эозинофилы, общий IgE, фракция выдыхаемого оксида азота и периостина). Параллельно были опробованы стратегии борьбы с IL-4 (пасколизумаб, питакинра и дупилумаб). До сих пор сообщалось, что дупилумаб способен снижать тяжесть астмы и частоту обострений. IL-13 и IL-4 имеют решающее значение в Th3-опосредованном воспалении при астме, но остается ясным, что только определенные эндотипы реагируют на эти методы лечения. Хотя использование стратегий против ИЛ-14 и против ИЛ-13 является многообещающим, срочно необходим поиск подходящих прогностических биомаркеров для более эффективного применения биологических методов лечения.

    © 2016 S. Karger AG, Базель


    Введение

    Астма — хроническое заболевание с высокой распространенностью. Фактически, в США им страдают около 24,6 миллиона человек, а во всем мире — около 334 миллионов человек всех возрастов [1]. Хотя смертность от астмы в целом снижается [2], она по-прежнему составляет 90–170 смертей на миллион. Кроме того, прямые (например, стационарное лечение и лекарства) и косвенные (например, потеря работы или учебные дни) затраты по-прежнему представляют собой серьезное бремя болезни.Стоимость лечения одного европейского пациента в год оценивается в 509 евро при контролируемой астме и 2281 евро при неконтролируемой астме [3]. Хотя астму часто можно контролировать с помощью стандартной ингаляционной терапии, клинические испытания показывают, что примерно у 20% пациентов, принимающих традиционные лекарства, астма остается неконтролируемой [4], а в реальной жизни ситуация еще хуже. С другой стороны, идея о том, что астма является отдельным заболеванием, недавно была подвергнута сомнению, и теперь она рассматривается как гетерогенное заболевание с различными патогенетическими механизмами, клиническим поведением и реакцией на лечение.

    Процесс фенотипирования астмы начался около 10 лет назад с целью выявления однородных групп (клинически или биологически) пациентов. Совсем недавно термин «эндотип» был введен, чтобы подчеркнуть более глубокую идентификацию астмы, включая генетические аспекты. В настоящее время идентифицировано более 100 генов, связанных с патогенезом астмы, но путь к полному пониманию генетического вклада, по-видимому, все еще долгий и извилистый, поскольку до сих пор не идентифицирован «ген астмы».В последние годы стало понятно, что разные фенотипы могут характеризоваться определенными молекулярными паттернами, что, возможно, позволяет прогнозировать ответ на конкретное лечение. Наиболее очевидным примером является открытие роли, которую играет T-хелпер 2 (Th3) лимфоцит-опосредованное воспаление (так называемое «Th3 high») примерно у половины пациентов, страдающих астмой. Впоследствии было проведено больше клинических испытаний, нацеленных на те молекулы, которые специфически связаны с воспалением Th3. Например, клинические испытания биологических агентов против Th3-ассоциированных цитокинов последовательно показывают более заметную эффективность у пациентов с маркерами повышенного Th3 воспаления, такими как эозинофилы [5,6].

    Несмотря на использование руководящих рекомендаций по ведению и терапии, определенное количество пациентов продолжают сообщать о неудовлетворительном контроле астмы, с ухудшением качества жизни, обострениями, повышенным использованием спасательных препаратов или системных кортикостероидов и отделением неотложной помощи / отделением интенсивной терапии. допуск. Примечательно, что примерно у 50% этих пациентов имеются убедительные доказательства патогенной роли цитокинов Th3, таких как интерлейкин (ИЛ) -4, ИЛ-5 и ИЛ-13, в регуляции эозинофильных и аллергических воспалительных процессов [7].

    Роль IL-13 и IL-4

    IL-4 и IL-13 были одними из первых Th3-родственных интерлейкинов, обнаруженных в начале 1980-х годов, и с тех пор они традиционно ассоциировались с атопией и аллергическими заболеваниями у женщин. общие, но также вовлечены в беременность, развитие плода, развитие молочных желез, лактацию и различные нейронные функции, включая когнитивные и обучающие процессы, а также формирование памяти [8,9,10]. Теоретически каждая клетка может отвечать на ИЛ-4, ИЛ-13 или оба, но некоторые типы клеток кажутся более восприимчивыми [11].

    Мы описали значимость IL-13 и IL-4 в патофизиологии астмы в отношении пролиферации бронхиальных фибробластов, миофибробластов и гладкомышечных клеток дыхательных путей, что приводит к ремоделированию дыхательных путей [12,13]. Индуцированная IL-13 роль в дифференцировке бокаловидных клеток, производстве слизи, гиперреактивности бронхов, синтезе иммуноглобулина E (IgE) (переключение выработки B-клеточных антител) и привлечении эозинофилов и базофилов [14,15,16,17,18, 19,20] было неоднократно продемонстрировано [21].

    Несколько клинических испытаний подчеркнули роль биологических агентов против IL-13 в борьбе с заболеванием астматического фенотипа «Th3 high», который характеризуется сверхэкспрессией индуцируемых IL-13 генов, таких как периостин [6]. Роль воспаления Th3 очевидна примерно у 50% пациентов с астмой, у которых наблюдается аномальная продукция провоспалительных цитокинов, таких как IL-4, IL-5 и IL-13, которые вызывают синтез IgE и эозинофильное воспаление [22]. . Эффекторные клетки Th3 после активации стимулирующими факторами, такими как аллергены, загрязнители или инфекционные агенты, высвобождают вышеупомянутые цитокины, которые действуют на поверхностные клетки.Несколько исследований продемонстрировали, что продукция IL-4, IL-5 и IL-13 связана с ответом врожденных лимфоидных клеток 2 типа (ILC2) на IL-25, IL-33, стромальный лимфопоэтин тимуса (TSLP) и лейкотриены [23]. Высокие концентрации ILC2 были показаны у пациентов с полипозом носа и / или высоким количеством эозинофилов в крови [6,24].

    Ил-4 был открыт в 1980-х годах. Он секретируется активированными Т-клетками, тучными клетками, базофилами и эозинофилами [25]. Существует тесная связь между активностью IL-4 и IL-13: оба активируют α-субъединицу рецептора IL-4 (IL-4Rα), и IL-4 также активирует субъединицу γC, в то время как IL-13 стимулирует IL- 13 субъединица α1 рецептора (IL-13Rα1) [26].Роль IL-4 связана с лимфоцитами фенотипа Th3. Он регулирует синтез IgE B-клетками, а также апоптоз и экспрессию многочисленных генов, участвующих в созревании макрофагов, фибробластов, эпителиальных и эндотелиальных клеток [27] (рис. 1).

    Рис. 1

    Диаграмма потенциальных клеточных эффектов IL-4 и IL-13 на воспалительные и структурные клетки при астме. После взаимодействия с вредными агентами, включая аллергены, вирусы и протеазы, эпителиальные клетки легких могут продуцировать TSLP, IL-25 и IL-33.Эти цитокины активируют специфические рецепторы на ILC2 и управляют их размножением. Активированные ILC2 являются центральными медиаторами иммунных ответов типа 2 в легких. После активации ILC2 и тучные клетки продуцируют несколько цитокинов, включая IL-13. IL-13 вызывает несколько клеточных изменений в дыхательных путях, включая гиперплазию бокаловидных клеток и образование слизи, пролиферацию гладкомышечных клеток дыхательных путей, пролиферацию фибробластов и поляризацию альтернативно активируемых макрофагов. IL-4, продуцируемый Th3-клетками и базофилами, активирует альтернативно активированные макрофаги и эозинофилы и индуцирует синтез IgE из B-лимфоцитов и плазматических клеток.IgE связывается с рецепторами FcεRI на тучных клетках и базофилах человека. Сшивка IgE аллергенами вызывает высвобождение гистамина, цис-лейкотриенов (Cys-LT), PAF, простагландина D 2 (PGD 2 ), цитокинов и хемокинов, которые ответственны за некоторые симптомы астмы.

    Обзор передачи сигналов рецептора IL-4 / IL-13

    Циркулирующие IL-4 и IL-13 связываются со специфическим рецептором, который экспрессируется на различных клетках, включая B-лимфоциты, эозинофилы, базофилы, моноциты и макрофаги, дендритные клетки, эндотелиальные клетки, фибробласты, эпителиальные клетки дыхательных путей и гладкомышечные клетки [28].Рецептор представляет собой гетеродимерный комплекс IL-13Rα и IL-4Rα. Циркулирующий IL-13 сначала задействует субъединицу IL-13Rα1, и это событие приводит к рекрутированию IL-4Rα. Связывание с комплексом IL-13Rα1 / IL-4Rα инициирует активацию нескольких путей трансдукции, включая тирозинкиназу 2 (Tyk-2) и киназу Януса 1 (JAK1), которые связаны с субъединицей IL-13R [29]. Активация этих систем трансдукции индуцирует фосфорилирование и активацию белков, преобразователя сигнала и активатора транскрипции 6 (STAT6) и субстрата рецептора инсулина 2 (IRS-2) [29], которые перемещаются из цитоплазмы в ядро ​​и активируют другие процессы трансдукции, такие как фосфатидилинозитид-3-киназа (PI3-K) [30,31,32], серин-треониновая протеинкиназа [33,34,35,36] и ядерный фактор, усиливающий каппа-легкую цепь активированного В-клетки (NF-κB) [37,38,39].IL-13R имеет другую рецепторную цепь, IL-13Rα2, которая не активирует процессы трансдукции, но может играть регулирующую роль в индуцированных IL-13 эффектах [40] и была связана с раком легких человека в качестве потенциальной мишени для новых методов лечения. [41].

    Биомаркеры

    По мере того, как роль специфических цитокинов при астме становилась все более ясной, были идентифицированы специфические биомаркеры Th3 воспаления дыхательных путей. Биомаркеры могут помочь разделить астму на различные подтипы (эндотипы), отражающие преобладающий патофизиологический механизм [42], помогая прогнозировать будущий риск [43] и нацеливать терапию, ориентированную на Th3, на пациентов, которые могут ответить.Выявленные к настоящему времени Th3-специфические биомаркеры включают эозинофилы мокроты / крови, общий сывороточный IgE, фракцию выдыхаемого оксида азота (FeNO) и белки, происходящие из бронхиального эпителия.

    Первым биомаркером, идентифицированным и использованным для прогнозирования кортикостероидного ответа, было количество эозинофилов в мокроте и крови. Woodruff et al. [44] обнаружили, что пациенты с астмой с повышенной бронхиальной экспрессией IL-5 и IL-13 имели более высокое количество эозинофилов в крови, чем контрольная группа, не страдающая астмой. Спустя несколько лет Jia et al.[24] продемонстрировали слабую корреляцию между количеством эозинофилов в крови и дыхательных путях, что свидетельствует об ограниченной чувствительности и воспроизводимости этого биомаркера Th3 воспаления. Кроме того, они представили экспериментальные доказательства того, что периостин связан с воспалением IL-13 и Th3.

    Больных с астмой можно разделить на 2 основные подгруппы, как страдающих эозинофильной или неозинофильной астмой, согласно 2% -ному отсечению эозинофилии мокроты на основе бронхоскопии [45,46,47], которое положительно коррелирует с экспрессией IL-13. в подслизистой оболочке бронхов, что указывает на то, что количество эозинофилов в мокроте может быть маркером воспаления Th3 [48].

    IL-4 и IL-13 также регулируют синтез IgE, и можно предположить, что общий сывороточный IgE является биомаркером фенотипов астмы [49]. К сожалению, общий IgE имеет низкую чувствительность и плохо коррелирует с эозинофильным воспалением [24].

    IL-13 способствует активности NO-синтазы и продукции NO, поэтому повышенный уровень FeNO является хорошим показателем воспаления Th3 и высокого уровня IL-13 в слизистой оболочке бронхов [50]. Кроме того, FeNO можно также использовать в качестве предиктора чувствительности к стероидам более последовательно, чем другие параметры.Было показано, что пациенты с высоким уровнем FeNO лучше реагируют на стероидную терапию по сравнению с пациентами с более низким уровнем FeNO [51]. Как и в случае с FeNO, другие данные показывают, что чем ниже уровень эозинофилов, тем хуже ответ на терапию [52,53].

    Другими появляющимися биомаркерами, которые могут быть полезны для стратификации пациентов с астмой, являются периостин и остеопонтин. Оба являются матричными белками, связанными с воспалением Th3 из-за их регулирующей роли в миграции клеток, ремоделировании внеклеточного матрикса, росте и образовании метастазов при различных злокачественных новообразованиях, трансформирующем бета-факторе роста (TGF-β) и синтезе коллагена, что приводит к ремоделированию дыхательных путей [54 , 55,56,57].Фактически, высокое воспаление Th3 характеризуется высоким уровнем экспрессии индуцибельных генов IL-13 и IL-4, включая периостин [58]. Концентрация остеопонтина и периостина в мокроте и сыворотке связана с рефрактерным эозинофильным воспалением дыхательных путей и ускоренным снижением легочной функции у пациентов, получающих терапию ингаляционными кортикостероидами (ИКС) [59, 60, 61]. Таким образом, они могут предсказывать ответ на терапию анти-IL-13 у пациентов, нечувствительных к ICS, помогая стратифицировать пациентов, у которых ожидается соответствующее улучшение функции легких.Нагасаки и др. [62] изучали 121 пациента с астмой, получавшего лечение ICS. Они оценили уровни FeNO и периостина в сыворотке и обнаружили, что среди 57 пациентов с высоким уровнем FeNO, 23 с сопутствующим высоким уровнем периостина в сыворотке имели ускоренное снижение легочной функции и более частые и тяжелые обострения астмы (несмотря на терапию высокими дозами ICS). Эти данные свидетельствуют о том, что комбинированная оценка FeNO и сывороточного периостина может быть полезна для выявления пациентов, нечувствительных к ICS.

    Все эти данные также предполагают, что эти биомаркеры предоставляют дополнительную информацию о различных аспектах воспаления Th3 и, следовательно, их использование следует сочетать в клинической терапии [63].

    Анти-ИЛ-13: анрукинзумаб, лебрикизумаб и тралокинумаб

    В соответствии с важной ролью ИЛ-13 в воспалении Th3 потенциальной терапевтической стратегией является блокирование взаимодействия ИЛ-13 со специфическим рецептором. Три моноклональных антитела в настоящее время проходят клиническую оценку.

    Анрукинзумаб представляет собой гуманизированное моноклональное антитело против IL-13, которое блокирует цитокин и предотвращает активацию IL-13Rα1 и IL-13Rα2. Анрукинзумаб был протестирован при астме и язвенном колите в исследованиях фазы II [64].

    Лебрикизумаб представляет собой гуманизированное моноклональное антитело IgG4, которое блокирует путь передачи сигнала через гетеродимер IL-4Rα / IL-13Rα1, связывая растворимый IL-13 и предотвращая его связь с рецептором [65,66]. Corren et al. [6] выполнили рандомизированное двойное слепое плацебо-контролируемое исследование лебрикизумаба среди 219 пациентов с астмой с неконтролируемым заболеванием в соответствии с терапией, рекомендованной руководящими принципами. Они обнаружили, что по сравнению с контрольной группой, получавшей плацебо, пациенты, получавшие лебрикизумаб в дозе 250 мг ежемесячно в течение 6 месяцев, имели более высокое увеличение объема форсированного выдоха за 1 секунду (ОФВ 1 ) по сравнению с исходным уровнем.Кроме того, пациенты с более высокими уровнями периостина в сыворотке крови до лечения имели большее улучшение функции легких при применении лебрикизумаба, чем пациенты с низким уровнем периостина (на 8,2% по сравнению с 1,6% выше, чем в группе плацебо), и более сильное снижение уровней FeNO в группе с высоким уровнем ферментации. подгруппа периостина [6]. Еще одно свидетельство эффективности лебрикизумаба было получено от Hanania et al. [67], которые провели 2 рандомизированных многоцентровых двойных слепых плацебо-контролируемых исследования и обнаружили, что лечение лебрикизумабом уменьшало обострения астмы, особенно в подгруппе пациентов с высоким уровнем периостина, со значительным снижением на 60% по сравнению с подгруппой пациентов с низким уровнем периостина (снижение на 5%).Второе исследование, проведенное Noonan et al. [68] продемонстрировали эффективность лебрикизумаба с точки зрения вариаций ОФВ 1 , хотя это не было статистически значимым, особенно у пациентов с высоким уровнем периостина. Эти данные подчеркнули потенциальную роль биомаркеров, таких как периостин, в выборе подходящей терапии. Было бы интересно узнать, все ли пациенты с высоким уровнем периостина были ответчиками, или были респондеры и неответчики в этой группе с высоким уровнем периостина.В целом, упомянутые данные дополнительно подтверждают различительную роль высокого периостина как прогностического биомаркера ответа на лебрикизумаб.

    Тралокинумаб — человеческое интерлейкин-13-нейтрализующее моноклональное антитело IgG4, которое было протестировано при тяжелой неконтролируемой астме, язвенном колите и идиопатическом легочном фиброзе. В первом исследовании астмы средней и тяжелой степени тяжести Piper et al. [69] показали хорошие результаты в отношении вариаций качества жизни у субъектов, получавших лечение, по сравнению с группой плацебо.Брайтлинг и др. [70] провели еще одно рандомизированное двойное слепое плацебо-контролируемое многоцентровое исследование фазы 2b в параллельных группах, показав приемлемый профиль переносимости и безопасности тралокинумаба, но незначительное снижение частоты обострений астмы. Некоторые частично обнадеживающие результаты были обнаружены в подгруппе пациентов с более высоким исходным уровнем дипептидилпептидазы-4 (DPP-4) и периостина. Эти данные свидетельствуют о возможном лечебном эффекте в определенных группах населения. Этот эффект в настоящее время также анализируется в продолжающемся исследовании фазы 3, вместе с возможным использованием DPP-4 и периостина в качестве биомаркеров активации пути интерлейкина-13.В соответствии с ролью, которую IL-13 играет в ремоделировании дыхательных путей и пролиферации фибробластов, а также положительным эффектом тралокинумаба в снижении уровня IL-13 [12,13], который способствует воспалению дыхательных путей, использование тралокинумаба в настоящее время также исследуется у пациентов с идиопатический легочный фиброз, особенно в быстро прогрессирующих формах, когда IL-13 сверхэкспрессируется в легочной ткани [71] (рис. 2).

    Рис. 2

    Новые методы лечения астмы, нацеленные на IL-4, IL-13 или их рецепторы.IL-4 передает сигналы через рецепторы типа I (IL-4Rα + γc) и типа II (IL-4Rα + IL-13Rα1), тогда как IL-13 связывается с рецепторами типа II (IL-4Rα + IL-13Rα1) и с IL-13Rα2. , который не содержит трансмембранного сигнального домена. Пасколизумаб представляет собой гуманизированное моноклональное антитело против ИЛ-4. Дупилумаб и питракинра предотвращают взаимодействия IL-4 / IL-13 с IL-4Rα рецепторного комплекса IL-4 и IL-13. Лебрикизумаб и тралокинумаб представляют собой гуманизированные моноклональные антитела, нацеленные на IL-13. Анрукинзумаб представляет собой гуманизированное моноклональное антитело против IL-13, которое ингибирует нисходящий сигнал IL-13 / IL-13Rα1 посредством блокирующего взаимодействия между IL-13 и IL-4Rα.

    Анти-ИЛ-4: пасколизумаб, питракинра и дупилумаб

    ИЛ-4, продуцируемый Т-лимфоцитами, активированными тучными клетками и базофилами, участвует в развитии астмы благодаря своей роли во многих клеточных механизмах, таких как выработка IgE, хемотаксис эозинофилов и развитие эффекторных Т-клеточных ответов [72]. Одна из основных ролей IL-4 — способствовать дифференцировке недифференцированных Т-хелперных (TH0) клеток в Th3-клетки. Перекос TH0 к Th3 способствует последующей продукции цитокинов и медиаторов, участвующих в воспалении дыхательных путей, обструкции и гиперреактивности, типичных для астмы [73].IL-4 также участвует в производстве IL-5. Таким образом, блокирование ИЛ-4 может быть разумной стратегией для контроля Th3 воспаления и снижения ИЛ-5-зависимой легочной эозинофилии [74]. Поскольку IL-4 способствует выработке коллагена и синтезу фибронектина, фундаментальным событиям ремоделирования дыхательных путей, его ингибирование может играть важную роль в предотвращении долгосрочного ремоделирования дыхательных путей у пациентов с тяжелой астмой [75]. Различные клетки вносят вклад в продукцию IL-4 в дыхательных путях, особенно эозинофилы, базофилы, тучные клетки и ILC2 [23].Традиционно клетки Th3 считаются основным клеточным источником архетипических цитокинов Th3. Недавно ILC2 были идентифицированы как альтернативный источник IL-4, IL-5, IL-9 и IL-13 в ответ на циркулирующие IL-25, IL-33 и TSLP. Этих клеток достаточно, чтобы вызвать аллергический ответ у мышей [76]. Недавно была продемонстрирована роль ILC2s в аллергических заболеваниях человека, характеризующихся эозинофильным воспалением, таких как носовые полипы и атопический дерматит [77]. Повышенные уровни ILC2 в периферической крови также были обнаружены у пациентов с астмой [78].Лю и др. [79] проанализировали уровни ILC2 в периферической крови в качестве альтернативного и практического биомаркера эозинофильного воспаления у пациентов с астмой легкой и средней степени тяжести, которым может помочь Th3-таргетная терапия, и обнаружили чувствительность 67,7% и специфичность 95,3%.

    Ингибирование IL-4 может осуществляться либо путем прямого блокирования IL-4, либо косвенно путем блокирования рецепторов IL-4 / IL-13. Hart et al. [80] оценивали эффективность и безопасность пасколизумаба, гуманизированного моноклонального антитела против IL-4, и его мышиного родительского антитела 3B9.Их исследование показало, что пасколизумаб специфически связывает IL-4 с низкой скоростью диссоциации. Исследования in vivo демонстрируют хорошую переносимость с небольшим накоплением препарата после хронического приема из-за его длительного периода полувыведения. Не было обнаружено токсичности или гистопатологических данных. Хотя в клинических испытаниях было обнаружено, что пасколизумаб хорошо переносится, он не вызывал значительного снижения циркулирующего IgE, поэтому испытания были прерваны [81].

    Pitrakinra, антагонист IL-4Rα / IL-13Rα, оценивали путем ингаляции и подкожного введения [82].Двойное слепое испытание с ингаляционной питракинрой (10 мг) не продемонстрировало измеримой клинической эффективности агента, но обострения астмы были значительно уменьшены в подгруппе пациентов с умеренной и тяжелой астмой со специфическими вариантами аминокислот на 3′-конце. гена IL-4Rα (IL4RA) [83]. Другое клиническое исследование эффективности питракинры у пациентов с атопической астмой продемонстрировало меньшее снижение легочной функции в активной группе, чем в контрольной группе [84].

    Дупилумаб — еще одно моноклональное антитело, блокирующее альфа-субъединицу рецептора IL-4 / IL-13 [85].Wenzel et al. [86] провели двойное слепое плацебо-контролируемое клиническое исследование фазы 2А с дупилумабом у взрослых пациентов с умеренными и тяжелыми симптомами астмы и высоким уровнем эозинофилов в крови (> 300 клеток / мкл) или уровнем эозинофилов в мокроте (> 3%). Количество обострений астмы было значительно ниже в активной группе (3 против 23), а ОФВ 1 значительно увеличился по сравнению с исходным уровнем. Хотя дупилумаб вызывает снижение биомаркеров Th3 воспаления, то есть FeNO, эотаксина-3, тимуса и регулируемых активацией хемокинов (TARC), значительного влияния на количество эозинофилов в крови обнаружить не удалось [87].

    Другое продолжающееся в настоящее время исследование фазы 3 (NCT02528214) оценивает эффекты дупилумаба у астматических пациентов с тяжелой системной стероид-зависимой астмой. Дупилумаб также был предложен для лечения других заболеваний, связанных с Th3, таких как атопический дерматит, из-за его роли в ингибировании путей IL-4 и IL-13. Предварительные результаты таких исследований обнадеживают, и дупилумаб, по-видимому, эффективнее циклоспорина из-за его меньших побочных эффектов и хорошего ответа на терапию [88].В других исследованиях, посвященных оценке дупилумаба при заболеваниях, связанных с Th3, изучается его возможное использование при полипозе носа, хроническом риносинусите [89] и эозинофильном эзофагите (NCT02379052, фаза 2) (таблица 1).

    Таблица 1

    Основные клинические исследования биологических препаратов против ИЛ-4 и ИЛ-13 при астме

    Выводы

    Путь к персонализированной медицине теперь стал реальностью, и его изучение приведет к соответствующей революции в модальностях назначения лекарств. астма.Новая концепция — это переход от эпохи «одного размера для всех» к эпохе «один размер не подходит всем». В настоящее время мы живем в ситуации, когда мы предлагаем множество решений проблемы трудноизлечимой астмы. В связи с возрастающей важностью биомаркеров для выбора правильного лекарства, еще одним желательным терапевтическим шагом будет наличие готовых растворов, которые можно будет применять с первого посещения. Быстрое измерение биомаркеров (сывороточного периостина, FeNo, эозинофилов и т. Д.) Будет иметь основополагающее значение при выборе более подходящего препарата для каждого отдельного пациента.Альтернативой может быть последовательное использование моноклональных препаратов («комбинированная терапия»), сначала выбирается лекарство, которое действует через определенный иммунологический механизм, а затем второе, специфичное для других путей. Например, пациентам с концентрацией IgE, слишком высокой для применения омализумаба, можно предложить анти-IL-4, а затем, как только уровни IgE снизятся, можно будет назначить анти-IgE. Еще одна важная неудовлетворенная потребность — продолжительность терапии. Это явно проявляется в отношении омализумаба, где нет стандартизированного протокола о том, когда следует прекратить лечение.Еще один открытый вопрос и возможная цель дальнейших исследований — это использование молекул, нацеленных на разные интерлейкины одновременно, чтобы одновременно охватить несколько терапевтических мишеней воспаления.

    Выражение признательности

    Эта статья была частично поддержана ARMIA (Associazione Ricerca Malattie Immunologiche e Allergiche) в Генуе.

    Заявление о раскрытии информации

    Все авторы заявили об отсутствии конфликта интересов.

    Список литературы

    1. Центры по контролю и профилактике заболеваний: жизненно важные признаки: распространенность астмы, характеристики болезни и обучение самоуправлению: США, 2001-2009 гг.MMWR Morb Mortal Wkly Rep 2011; 60: 547-552.
    2. Вианелло А., Каминати М., Кривелларо М., Эль-Мазлум Р., Снэнги Р., Росси А., Фести Г., Бово С., Пассалаква Г., Каноника Г. В., Сенна Г.: Смертельная астма. По-прежнему эпидемия. Респир Мед 2016, в печати.
    3. Accordini S, Corsico AG, Braggion M, Gerbase MW, Gislason D, Gulsvik A, Heinrich J, Janson C, Jarvis D, Jõgi R, Pin I, Schoefer Y, Bugiani M, Cazzoletti L, Cerveri I, Marcon A, de Marco R: Стоимость стойкой астмы в Европе: международное популяционное исследование среди взрослых.Int Arch Allergy Immunol 2013; 160: 93-101.
    4. Бейтман Э.Д., Буши Х.А., Буске Дж., Бусс В.В., Кларк Т.Дж., Пауэлс Р.А., Педерсен С.Е.; ЦЕЛЬ Исследовательская группа: Можно ли достичь контроля над астмой в соответствии с рекомендациями? Исследование достижения оптимального контроля над астмой. Am J Respir Crit Care Med 2004; 170: 836-844.
    5. Haldar P, Brightling CE, Hargadon B, Gupta S, Monteiro W., Sousa A, Marshall RP, Bradding P, Green RH, Wardlaw AJ, Pavord ID: Меполизумаб и обострения рефрактерной эозинофильной астмы. N Engl J Med 2009; 360: 973-984.
    6. Коррен Дж., Леманске Р.Ф., Ханания Н.А., Коренблат П.Е., Парси М.В., Аррон Дж.Р., Харрис Дж.М., Шееренс Х., Ву Л.К., Су З., Мосесова С., Эйснер М.Д., Бохен С.П., Мэтьюз Дж. Г.: Лечение лебрикизумабом у взрослых с астмой.N Engl J Med 2011; 365: 1088-1098.
    7. Chung KF: Нацеливание на путь интерлейкина при лечении астмы. Ланцет 2015; 386: 1086-1096.
    8. Гадани С.П., Кронк Дж. С., Норрис Г. Т., Кипнис Дж.: Интерлейкин-4: цитокин, который следует запомнить.J. Immunol 2012; 189: 4213-4219.
    9. Derecki NC, Cardani AN, Yang CH, Quinnies KM, Crihfield A, Lynch KR, Kipnis J: Регулирование обучения и памяти менингеальным иммунитетом: ключевая роль IL-4. J Exp Med 2010; 207: 1067-1080.
    10. Линч М.А.: Возрастные нейровоспалительные изменения негативно влияют на функцию нейронов.Front Aging Neurosci 2010; 1: 6.
    11. Маккормик С.М., Хеллер Н.М.: Комментарий: рецепторы IL-4 и IL-13 и передача сигналов. Цитокин 2015; 75: 38-50.
    12. Doucet C, Brouty-Boyé D, Pottin-Clemenceau C, Jasmin C, Canonica GW, Azzarone B: IL-4 и IL-13 специфически увеличивают молекулу адгезии и экспрессию воспалительных цитокинов в фибробластах легких человека.Б. Инт Иммунол 1998; 10: 1421-1433.
    13. Doucet C, Brouty-Boyé D, Pottin-Clémenceau C, Canonica GW, Jasmin C, Azzarone B: Интерлейкин (IL) 4 и IL-13 действуют на фибробласты легких человека. Последствия для астмы. Дж. Клин Инвест 1998; 101: 2129-2139.
    14. Richter A, Puddicombe SM, Lordan JL, Bucchieri F, Wilson SJ, Djukanovic R, Dent G, Holgate ST, Davies DE: Вклад интерлейкина (IL) -4 и IL-13 в эпителиально-мезенхимальную трофическую единицу при астме.Am J Respir Cell Mol Biol 2001; 25: 385-391.
    15. Bossé Y, Thompson C, Audette K, Stankova J, Rola-Pleszczynski M: Интерлейкин-4 и интерлейкин-13 усиливают пролиферацию гладкомышечных клеток бронхов человека. Int Arch Allergy Immunol 2008; 146: 138-148.
    16. Кондо М., Тамаоки Дж., Такеяма К., Исоно К., Каватани К., Идзумо Т., Нагаи А. Устранение IL-13 отменяет установленную метаплазию бокаловидных клеток в мерцательный эпителий в культуре эпителиальных клеток дыхательных путей.Аллергол Инт 2006; 55: 329-336.
    17. Чиба Ю., Накадзава С., Тодороки М., Шинозаки К., Сакаи Х., Мисава М.: Интерлейкин-13 увеличивает сократимость гладких мышц бронхов за счет активации белка RhoA. Am J Respir Cell Mol Biol 2009; 40: 159-167.
    18. Пуннонен Дж., Аверса Дж., Кокс Б. Г., Маккензи А. Н., Менон С., Зуравски Дж., Де Ваал Малефит Р., де Фрис Дж. Э .: Интерлейкин 13 индуцирует независимый от интерлейкина 4 синтез IgG4 и IgE и экспрессию CD23 В-клетками человека.Proc Natl Acad Sci USA 1993; 90: 3730-3734.
    19. Хори С., Окубо Ю., Хоссейн М., Сато Е., Номура Н., Кояма С., Сузуки Дж., Исобе М., Секигучи М. Интерлейкин-13, но не интерлейкин-4, продлевает выживание эозинофилов и индуцирует хемотаксис эозинофилов. Intern Med 1997; 36: 179-185.
    20. Luttmann W, Knoechel B, Foerster M, Matthys H, Virchow JC Jr, Kroegel C: Активация человеческих эозинофилов IL-13.Индукция поверхностного антигена CD69, его связь с экспрессией информационной РНК и повышение жизнеспособности клеток. J. Immunol 1996; 157: 1678-1683.
    21. Дэвис Д.Е., Уикс Дж., Пауэлл Р.М., Паддикомб С.М., Холгейт С.Т.: Ремоделирование дыхательных путей при астме: новые открытия. J Allergy Clin Immunol 2003; 111: 215-225; Виктория 226.
    22. Холгейт ST: Врожденные и адаптивные иммунные ответы при астме. Нат Мед 2012; 18: 673-683.
    23. KleinJan A: Воспаление дыхательных путей при астме: ключевые игроки за пределами пути Th3.Curr Opin Pulm Med 2016; 22: 46-52.
    24. Джиа Джи, Эриксон Р.В., Чой Д.Ф., Мосесова С., Ву Л.К., Сольберг О.Д., Шикотра А., Картер Р., Аудуссо С., Хамид К., Брэддинг П., Фахи СП, Вудрафф П.Г., Харрис Дж. М., Аррон Дж. Р.; Периостин является системным биомаркером эозинофильного воспаления дыхательных путей у пациентов с астмой.Бронхоскопическое исследовательское исследование биомаркеров в группе изучения кортикостероидной резистентной астмы (BOBCAT). J Allergy Clin Immunol 2012; 130: 647-654.
    25. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE: рецептор IL-4: механизмы передачи сигналов и биологические функции. Анну Рев Иммунол 1999; 17: 701-738.
    26. Oh CK, Geba GP, Molfino N: исследовательские терапевтические средства, нацеленные на путь IL-4 / IL-13 / STAT-6 для лечения астмы. Eur Respir Rev 2010; 19: 46-54.
    27. Gour N, Wills-Karp M: передача сигналов IL-4 и IL-13 при аллергическом заболевании дыхательных путей.Цитокин 2015; 75: 68-78.
    28. Коррен Дж .: Роль интерлейкина-13 при астме. Curr Allergy Asthma Rep.2013; 13: 415-420.
    29. Chiba Y, Goto K, Misawa M: Индуцированная интерлейкином-13 активация сигнального преобразователя и активатора транскрипции 6 опосредуется активацией киназы Janus 1 в культивируемых клетках гладких мышц бронхов человека.Pharmacol Rep 2012; 64: 454-458.
    30. Sun XJ, Wang L-M, Zhang Y, Yenush L, Myers MG Jr, Glasheen E, Lane WS, Pierce JH, White MF: роль IRS-2 в передаче сигналов инсулина и цитокинов. Nature 1995; 377: 173-177.
    31. Dhand R, Hiles I, Panayotou G, Roche S, Fry MJ, Gout I, Totty NF, Truong O, Vicendo P, Yonezawa K и др.: PI 3-киназа представляет собой фермент с двойной специфичностью: ауторегуляция с помощью внутреннего белка-серина киназная активность.EMBO J 1994; 13: 522-533.
    32. Ruckerl D, Jenkins SJ, Laqtom NN, Gallagher IJ, Sutherland TE, Duncan S, Buck AH, Allen JE: Индукция IL-4Ralpha-зависимых микроРНК идентифицирует передачу сигналов PI3K / Akt как важную для IL-4-управляемой пролиферации макрофагов мыши in vivo . Кровь 2012; 120: 2307-2316.
    33. Хеллер Н.М., Ци Х, Гесберт Ф., Киган А.Д.: внеклеточные и трансмембранные домены цепей альфа1 рецептора гаммаС и интерлейкина (ИЛ) -13, а не их цитоплазматические домены, диктуют природу сигнальных ответов на ИЛ-4 и ИЛ-13. . J Biol Chem 2012; 287: 31948-31961.
    34. Karlsson HR, Zierath J: Передача сигналов инсулина и транспорт глюкозы в инсулинорезистентных скелетных мышцах человека. Cell Biochem Biophys 2007; 48: 103-113.
    35. Ландис Дж., Шоу Л.М.: Передача сигналов фосфатидилинозитол-3-киназы, опосредованная субстратом-2 рецептора инсулина, избирательно ингибирует киназу-3b гликогенсинтазы для регулирования аэробного гликолиза.J Biol Chem 2014; 289: 18603-18613.
    36. Russo SJ, Bolanos CA, Theobald DE, DeCarolis NA, Renthal W, Kumar A, Winstanley CA, Renthal NE, Wiley MD, Self DW, Russell DS, Neve RL, Eisch AJ, Nestler EJ: путь IRS2-Akt в дофаминовых нейронах среднего мозга регулирует поведенческие и клеточные реакции на опиаты.Нат Neurosci 2007; 10: 93-99.
    37. Микита Т., Кэмпбелл Д., Ву П., Уильямсон К., Шиндлер У.: Требования к экспрессии генов, индуцированной интерлейкином-4, и функциональная характеристика Stat6. Mol Cell Biol 1996; 16: 5811-5820.
    38. Шен C-H, Ставнезер Дж .: Взаимодействие stat6 и NF-κB: прямая ассоциация и синергетическая активация транскрипции, индуцированной интерлейкином-4.Mol Cell Biol 1998; 18: 3395-3404.
    39. Delphin S, Stavnezer J: Характеристика области, отвечающей за интерлейкин 4 (IL-4), в эпсилон-промоторе тяжелой цепи иммуноглобулина зародышевой линии: регуляция NF-IL-4, членом семейства C / EBP и NF-κB / p50. J Exp Med 1995; 181: 181-192.
    40. Zheng T, Liu W, Oh SY, Zhu Z, Hu B, Homer RJ, Cohn L, Grusby MJ, Elias JA: рецептор IL-13 альфа2 избирательно ингибирует индуцированные IL-13 ответы в легких мыши.J. Immunol. 2008; 180: 522-529.
    41. Xie M, Wu XJ, Zhang JJ, He CS: рецептор IL-13 α2 является отрицательным прогностическим фактором при раке легких человека и стимулирует рост рака легких у мышей. Oncotarget 2015; 6: 32902-32913.
    42. Bartminski G, Crossley M, Turcanu V: Новые биомаркеры для стратификации астмы и индивидуальной терапии.Эксперт Rev Mol Diagn 2015; 15: 415-430.
    43. Muñoz X, Bustamante V, Lopez-Campos JL, Cruz MJ, Barreiro E: Полезность неинвазивных методов для изучения бронхиального воспаления в контроле пациентов с астмой. Int Arch Allergy Immunol 2015; 166: 1-12.
    44. Woodruff PG, Modrek B, Choy DF, Jia G, Abbas AR, Ellwanger A, Koth LL, Arron JR, Fahy JV: воспаление, вызванное T-хелпером 2 типа, определяет основные субфенотипы астмы.Am J Respir Crit Care Med 2009; 180: 388-395.
    45. Венцель С.Е., Шварц Л. Б., Лангмак Е. Л., Халлидей Дж. Л., Трюдо Дж. Б., Гиббс Р. Л., Чу Х. У.: Доказательства того, что тяжелая астма может быть патологически разделена на два подтипа воспаления с различными физиологическими и клиническими характеристиками. Am J Respir Crit Care Med 1999; 160: 1001-1008.
    46. Spanevello A, Confalonieri M, Sulotto F, Romano F, Balzano G, Migliori GB, Bianchi A, Michetti G: индуцированная клеточность мокроты. Контрольные значения и распределение у нормальных добровольцев. Am J Respir Crit Care Med 2000; 162: 1172-1174.
    47. Dente FL, Latorre M, Novelli F, Cianchetti S, Bartoli ML, Bacci E, Di Franco A, Vagaggini B, Celi A, Paggiaro P: Может ли эозинофилия мокроты быть постоянным признаком тяжелых рефрактерных астматиков? Трехлетнее продольное исследование.Int Arch Allergy Immunol 2015; 166: 287-290.
    48. Саха С.К., Берри М.А., Паркер Д., Сиддики С., Морган А., Мэй Р., Монк П., Брэддинг П., Уордлоу А.Дж., Паворд И.Д., Брайтлинг С.Е.: Повышенная экспрессия IL-13 в мокроте и биопсии бронхов при тяжелой астме. J Allergy Clin Immunol 2008; 121: 685-691.
    49. Kuiper S, Muris JW, Dompeling E, van Schayck CP, Schönberger HJ, Wesseling G, Knottnerus JA: Связь между семейной предрасположенностью первой степени астмы и атопией (общим IgE) у новорожденных. Clin Exp Allergy 2006; 36: 594-601.
    50. Chibana K, Trudeau JB, Mustovich AT, Hu H, Zhao J, Balzar S, Chu HW, Wenzel SE: индуцированное IL-13 повышение уровней нитрита в первую очередь обусловлено увеличением индуцибельной синтазы оксида азота по сравнению с эффектами на аргиназы у человека. первичные бронхиальные эпителиальные клетки.Clin Exp Allergy 2008; 8: 936-946.
    51. Смит А.Д., Коуэн Дж.О., Брассетт К.П., Филселл С., Маклахлан К., Монти-Шихан Дж., Питер Гербисон Дж., Робин Тейлор Д: Оксид азота в выдыхаемом воздухе: предиктор стероидного ответа. Am J Respir Crit Care Med 2005; 172: 453-459.
    52. Brown HM: лечение хронической астмы преднизолоном; значение эозинофилов в мокроте.Ланцет 1958; 2: 1245-1247.
    53. Паворд И.Д., Брайтлинг С.Е., Вольтманн Г., Вардлоу А.Дж.: Астма, не отвечающая на эозинофильные кортикостероиды. Ланцет 1999; 353: 2213-2214.
    54. Гиллан Л., Матей Д., Фишман Д.А., Гербин С.С., Карлан Б.И., Чанг Д.Д.: Периостин, секретируемый эпителиальной карциномой яичников, является лигандом для интегринов альфа (V) бета (3) и альфа (V) бета (5) и способствует подвижности клеток .Cancer Res 2002; 62: 5358-5364.
    55. Wang X, Liu J, Wang Z, Huang Y, Liu W, Zhu X, Cai Y, Fang X, Lin S, Yuan L, Ouyang G: периостин способствует приобретению свойств, подобных мультипотентным стволовым клеткам, в эпителиальных клетках молочной железы человека. и клетки рака груди. PLoS One 2013; 8: e72962.
    56. Сидху С.С., Юань С., Иннес А.Л., Керр С., Вудрафф П.Г., Хоу Л., Мюллер С.Дж., Фахи Дж.В.: Роль периостина, полученного из эпителиальных клеток, в активации TGF-бета, выработке коллагена и эластичности геля коллагена при астме. Proc Natl Acad Sci USA 2010; 107: 14170-14175.
    57. Xanthou G, Alissafi T, Semitekolou M, Simoes DC, Economidou E, Gaga M, Lambrecht BN, Lloyd CM, Panoutsakopoulou V: Остеопонтин играет решающую роль в аллергических заболеваниях дыхательных путей через регуляцию субпопуляций дендритных клеток.Нат Мед 2007; 13: 570-578.
    58. Такаяма Г., Арима К., Канаджи Т., Тода С., Танака Х., Сёдзи С., Маккензи А.Н., Нагаи Х., Хотокебучи Т., Изухара К.: Периостин: новый компонент субэпителиального фиброза бронхиальной астмы после IL-4 и IL-13. сигналы. Журнал Allergy Clin Immunol 2006; 118: 98-104.
    59. Канемицу Й, Мацумото Х, Идзухара К., Тохда Й, Кита Х, Хоригути Т., Кувабара К., Томии К., Оцука К., Фудзимура М, Окура Н., Томита К., Йокояма А, Охниши Х, Накано Й, Огума Т, Ходзава С. , Nagasaki T, Ito I, Oguma T, Inoue H, Tajiri T, Iwata T, Izuhara Y, Ono J, Ohta S, Tamari M, Hirota T, Yokoyama T, Niimi A, Mishima M: увеличение количества периостинов связано с большим ограничением воздушного потока у пациентов, получающих ингаляционные кортикостероиды.Журнал Allergy Clin Immunol 2013; 132: 305-312.
    60. Делимпура В., Бакакос П., Целиу Э., Бесса В., Хиллас Г., Симоес Д. К., Папирис С., Лукидес С. Повышенные уровни остеопонтина в надосадочной жидкости мокроты при тяжелой рефрактерной астме. Thorax 2010; 65: 782-786.
    61. Нагасаки Т, Мацумото Х, Канемицу Й, Изухара К., Тохда Й, Кита Х, Хоригути Т, Кувабара К., Томии К., Оцука К., Фудзимура М, Окура Н., Томита К., Йокояма А, Охниши Х, Накано Й, Огума Т. , Hozawa S, Ito I, Oguma T, Inoue H, Tajiri T, Iwata T., Izuhara Y, Ono J, Ohta S, Yokoyama T, Niimi A, Mishima M: интеграция продольной информации о функции легких и воспалении с использованием фенотипов астмы.Журнал Allergy Clin Immunol 2014; 133: 1474-1477.
    62. Нагасаки Т, Мацумото Х, Канемицу Й, Изухара К., Тохда Й, Хоригути Т, Кита Х, Томии К., Фудзимура М, Йокояма А, Накано Й, Ходзава С., Ито I, Огума Т, Изухара Й, Тадзири Т, Ивата Т , Ono J, Ohta S, Yokoyama T., Niimi A, Mishima M: Использование выдыхаемого оксида азота и сывороточного периостина в качестве комбинированного маркера для выявления тяжелой / нечувствительной к стероидам астмы.Am J Respir Crit Care Med 2014; 190: 1449-1452.
    63. Де Феррари Л., Чиаппори А., Баньяско Д., Риччио А. М., Пассалаква Г., Каноника Г. В.: Молекулярное фенотипирование и разработка биомаркеров: находимся ли мы на пути к таргетной терапии тяжелой астмы? Эксперт Рев Респир Мед 2016; 10: 29-38.
    64. Хуа Ф., Риббинг Дж., Рейниш В., Катальди Ф., Мартин С.: Фармакокинетическое сравнение анрукинзумаба, моноклонального антитела против ИЛ-13, среди здоровых добровольцев, пациентов с астмой и язвенным колитом. Br J Clin Pharmacol 2015; 80: 101-109.
    65. Ultsch M, Bevers J, Nakamura G, Vandlen R, Kelley RF, Wu LC, Eigenbrot C: Структурная основа блокады передачи сигналов лебрикизумабом антителом к ​​IL-13.Журнал Мол. Биол, 2013; 425: 1330-1339.
    66. Scheerens H, Arron JR, Zheng Y, Putnam WS, Erickson RW, Choy DF, Harris JM, Lee J, Jarjour NN, Matthews JG: Эффекты лебрикизумаба у пациентов с легкой астмой после заражения аллергеном всего легкого. Clin Exp Allergy 2014; 44: 38-46.
    67. Ханания Н.А., Нунан М., Коррен Дж., Коренблат П., Чжэн Й., Фишер С.К., Чеу М., Путнам В.С., Мюррей Э., Шееренс Х., Холвег К.Т., Мачука Р., Грей С., Дойл Р., МакКлинток Д., Олссон Дж., Мэтьюз Дж. , Йен К.: Лебрикизумаб при астме средней и тяжелой степени тяжести: объединенные данные двух рандомизированных плацебо-контролируемых исследований.Торакс 2015; 70: 748-756.
    68. Нунан М., Коренблат П., Мосесова С., Шееренс Х., Аррон Дж. Р., Чжэн Ю., Путнам В.С., Парси М.В., Бохен С.П., Мэтьюз Дж. Г.: Исследование диапазона доз лебрикизумаба у пациентов с астмой, не получающих ингаляционные стероиды. J Allergy Clin Immunol 2013; 132: 567-574.e12.
    69. Piper E, Brightling C, Niven R, Oh C, Faggioni R, Poon K, She D, Kell C, May RD, Geba GP, Molfino NA: плацебо-контролируемое исследование фазы II тралокинумаба при астме средней и тяжелой степени. Eur Respir J 2013; 41: 330-338.
    70. Brightling CE, Chanez P, Leigh R, O’Byrne PM, Korn S, She D., May RD, Streicher K, Ranade K, Piper E: Эффективность и безопасность тралокинумаба у пациентов с тяжелой неконтролируемой астмой: рандомизированный, двойной слепой плацебо-контролируемое исследование фазы 2b.Ланцет Респир Мед 2015; 3: 692-701.
    71. Murray LA, Zhang H, Oak SR, Coelho AL, Herath A, Flaherty KR, Lee J, Bell M, Knight DA, Martinez FJ, Sleeman MA, Herzog EL, Hogaboam CM: нацеливание на интерлейкин-13 с помощью тралокинумаба ослабляет фиброз легких и эпителиальный повреждение в гуманизированной модели идиопатического легочного фиброза SCID.Am J Respir Cell Mol Biol 2014; 50: 985-994.
    72. Риччи М: ИЛ-4: ключевой цитокин при атопии. Clin Exp Allergy 1994; 24: 801-812. Pauwels RA, Brusselle GG, Tournoy KG, Lambrecht BN, Kips JC: Цитокины и их рецепторы как терапевтические мишени при астме. Clin Exp Allergy 1998; 28 (приложение 3): 1-5.
    73. Риччи М., Матуччи А., Росси О. ИЛ-4 как ключевой фактор, влияющий на развитие аллерген-специфических Th3-подобных клеток у лиц с атопией. Дж. Инвест Аллергол Клин Иммунол 1997; 7: 144-150.
    74. Garlisi CG, Kung TT, Wang P Minnicozzi M, Umland SP, Chapman RW, Stelts D, Crawley Y, Falcone A, Myers JG, Jones H, Billah MM, Kreutner W, Egan RW: Эффекты хронических моноклональных антител к интерлейкину-5 лечение антителами на мышиной модели воспаления легких.Am J Respir Cell Mol Biol 1999; 20: 248-255.
    75. Buttner C, Skupin A, Reimann T., Rieber EP, Unteregger G, Geyer P, Frank KH: Местное производство интерлейкина-4 во время радиационно-индуцированного пневмонита и легочного фиброза у крыс: макрофаги как важный источник интерлейкина-4.Am J Respir Cell Mol Biol 1997; 17: 315-325.
    76. Барлоу Дж. Л., Маккензи А. Н.: Врожденные лимфоидные клетки типа 2 при аллергических заболеваниях человека. Curr Opin Allergy Clin Immunol 2014; 14: 397-403.
    77. Walford HH, Lund SJ, Baum RE, White AA, Bergeron CM, Husseman J, Bethel KJ, Scott DR, Khorram N, Miller M, Broide DH, Doherty TA: Повышенные уровни ILC2 в эндотипе эозинофильного назального полипа связаны с реакцией на кортикостероиды.Clin Immunol 2014; 155: 126e135.
    78. Bartemes KR, Kephart GM, Fox SJ, Kita H: усиленный врожденный иммунный ответ 2 типа в периферической крови пациентов с астмой. Журнал Allergy Clin Immunol 2014; 134: 671-678.e4.
    79. Лю Т., Ву Дж, Чжао Дж, Ван Дж, Чжан И, Лю Л., Цао Л, Лю Ю, Дун Л: Врожденные лимфоидные клетки 2 типа: новый биомаркер эозинофильного воспаления дыхательных путей у пациентов с легкой и умеренной астмой.Респир Мед 2015; 109: 1391-1396.
    80. Харт Т.К., Блэкберн М.Н., Бригам-Берк М., Деде К., Аль-Махди Н., Зия-Амирхоссейни П., Кук Р.М.: Доклиническая эффективность и безопасность пасколизумаба (SB 240683): ​​гуманизированного антитела против интерлейкина-4 с терапевтическим потенциалом в астма. Clin Exp Immunol 2002; 130: 93-100.
    81. Walker BL, Leigh R: Использование биологических препаратов в качестве иммунотерапии при астме и связанных с ней заболеваниях. Эксперт Рев Клин Иммунол 2008; 4: 743-756.
    82. Pelaia G, Vatrella A, Maselli R: потенциал биопрепаратов для лечения астмы.Nat Rev Drug Discov 2012; 11: 958-972.
    83. Slager RE, Otulana BA, Hawkins GA, Yen YP, Peters SP, Wenzel SE, Meyers DA, Bleecker ER: полиморфизм рецептора IL-4 предсказывает уменьшение обострений астмы во время ответа на антагонист рецептора α против IL-4. Журнал Allergy Clin Immunol 2012; 130: 516-522.e4.
    84. Wenzel S, Wilbraham D, Fuller R, Getz EB, Longphre M: Влияние варианта интерлейкина-4 на позднюю фазу астматического ответа на аллерген у пациентов с астмой: результаты двух исследований фазы 2a. Ланцет 2007; 370: 1422-1431.
    85. Wechsler ME: Ингибирование интерлейкина-4 и интерлейкина-13 при трудноизлечимой астме.N Engl J Med 2013; 368: 2511-2513.
    86. Венцель С., Форд Л., Перлман Д., Спектор С., Шер Л., Скобиеранда Ф, Ван Л., Киркессели С., Роклин Р., Бок Б., Гамильтон Дж., Минг Дж. Э., Радин А., Шталь Н., Янкопулос Г. Д., Грэм Н., Пироцци Г. : Дупилумаб при стойкой астме с повышенным уровнем эозинофилов.N Engl J Med 2013; 368: 2455-2466.
    87. Vatrella A, Fabozzi I, Calabrese C, Maselli R, Pelaia G: Дупилумаб: новое лекарство от астмы. J Asthma Allergy 2014; 7: 123-130.
    88. Цианакас А., Стендер С: Дупилумаб: важный этап в лечении атопического дерматита.Ланцет 2016; 387: 4-5.
    89. Bachert C, Mannent L, Naclerio RM, Mullol J, Ferguson BJ, Gevaert P, Hellings P, Jiao L, Wang L, Evans RR, Pirozzi G, Graham NM, Swanson B, Hamilton JD, Radin A, Gandhi NA, Stahl N. , Янкопулос Г.Д., Сазерленд Р.: Влияние подкожного дупилумаба на нагрузку полипов носа у пациентов с хроническим синуситом и полипозом носа.Рандомизированное клиническое испытание. JAMA 2016; 315: 469-479.

    Автор Контакты

    Для корреспонденции: проф. Джорджио В. Каноника

    Аллергия и респираторные заболевания, Отделение внутренней медицины DIMI

    Университет Генуи, IRCCS AOU San Martino-IST

    Largo Rosanna Benzi 10, IT-16132 Genoa (Италия)

    Электронная почта canonica @ unige.это


    Подробности статьи / публикации

    Опубликовано онлайн: 3 августа 2016 г.
    Дата выпуска: август 2016 г.

    Количество страниц для печати: 10
    Количество рисунков: 2
    Количество столов: 1

    ISSN: 1018-2438 (печатный)
    eISSN: 1423-0097 (онлайн)

    Для дополнительной информации: https://www.karger.com/IAA


    Авторские права / Дозировка препарата / Заявление об ограничении ответственности

    Авторские права: Все права защищены.Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или с помощью какой-либо системы хранения и поиска информации, без письменного разрешения издателя. .
    Дозировка лекарств: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор и дозировка лекарств, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, ввиду продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю настоятельно рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным агентом является новый и / или редко применяемый препарат.
    Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.Появление в публикации рекламы и / или ссылок на продукты не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор (-ы) не несут ответственности за любой ущерб, причиненный людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в контенте или рекламе.

    HIF-2 альфа / EPAS1-антитело (NB100-122): Novus Biologicals


    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 15.03.2021

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Линия клеток гепатоцеллюлярной карциномы человека Hep3B
    Виды Человеческий
    Лот CI
    5

    проверено:
    Проверенный клиент

    WB Человек 05.07.2019

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Линии раковых клеток человека
    Виды Человек
    Лот CF

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 16.04.2019

    Сводка

    Заявка Вестерн-блот
    Образец протестирован HBE-16
    Виды Человек
    Лот CD-9
    5

    проверено:
    Проверенный клиент

    WB Человек 04.02.2019

    Сводка

    Приложение Вестерн-блот
    Образец протестирован культивированных клеток
    Виды Человек
    Лот Bv-02
    4

    проверено:
    Проверенный клиент

    WB Человек 02.02.2019

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Лизаты клеток 786O
    Виды Человек
    Лот BP2
    BP2

    Увеличить
    3

    проверено:
    Проверенный клиент

    ЧИП Человек 02.12.2018

    Сводка

    Приложение Иммунопреципитация хроматина
    Протестированный образец Клеточная линия MCF7
    Виды Человек
    Лот CD-13

    Увеличить
    4

    проверено:
    Проверенный клиент

    WB Человек 18.09.2018

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Раковые клетки человека
    Виды Человек
    Лот N / A

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 11.05.2018

    Сводка

    9
    Приложение Вестерн-блот
    Образец протестирован 293T Лизат клеток HEK
    Виды Человек
    Лот CD-2
    Комментарии Разведение антител — 1: 500 в 5% BSA — в течение ночи 4 градуса
    5

    проверено:
    Shanhai Xie

    WB Мышь 12.01.2017

    Сводка

    Заявка Вестерн-блот
    Образец протестирован лизат трансфицированных клеток U2OS
    Виды Мышь
    Лот
    5

    проверено:
    Проверенный клиент

    WB Человек 12.01.2017

    Сводка

    Приложение Вестерн-блот
    Образец протестирован культивированных клеток
    Виды Человек
    Лот BV-2

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Мышь 18.10.2016

    Сводка

    Приложение Вестерн-блот
    Образец протестирован CD4 + Т-клетки мыши
    Виды Мышь
    Лот BP-1
    9356 Комментарии
    Комментарии Разбавление (1: 1000)

    Увеличить
    5

    проверено:
    Helder Andre

    WB Человек 11.07.2016

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Первичный эндотелий сетчатки и хориоидеи
    Виды Человек

    Блокировка

    Блокирующие детали 5% молоко / TBS, 1 час, RT

    Первичное антенное тело

    Коэффициент разведения 1: 250 в 1% молоке / TBS, ON, 4C

    Вторичные антитела

    Вторичное описание свиной антикроличий IgG-HRP
    Вторичная концентрация 1: 5000 в 1% молока / TBS, 1 час, RT

    Подробнее


    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 31.03.2016

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Лизат клеточной линии HCT116
    Виды Человек
    Лот Блокировка BP-2
    9
    Блокирующие детали 5% обезжиренное молоко в TBS

    Первичное антенное тело

    Коэффициент разведения 1000 раз, инкубация в течение ночи при 4 ° C в 0.1% Твин-20 TBS 5% молоко

    Вторичные антитела

    75

    Подробные сведения

    Вторичное описание GE Healthcare Anti-Rabbit IgG HRP
    Вторичный производитель № по каталогу NA934V
    Вторичная концентрация 5000 разведение
    Примечания к обнаружению Обнаружение с использованием авторадиографической пленки, экспозиция 1 минута, 24 часа гипоксии в качестве положительного контроля.

    Увеличить
    4

    проверено:
    Проверенный клиент

    WB Человек 10.11.2015

    Сводка

    Приложение Вестерн-блот
    Образец протестирован фракции цитоплазматических и ядерных белков клеток U266
    Виды Человек

    Блокировка

    Детали блокировки 5% молоко в PBST, 30 минут при комнатной температуре

    Первичное антитело

    Коэффициент разведения 1 мкг / мл, на ночь, 4 ° C, PBST с 5% молоком

    Вторичные антитела

    Вторичное описание Козье антикроличье igG HRP
    Вторичный номер по каталогу производителя SC-2005
    Вторичная концентрация 1: 2000

    Детали

    Примечания к обнаружению Хемилюминесценция, G: Box Chemi XLT4, 12 секунд, без положительных и отрицательных контролей

    Комментарии

    Комментарии Это антитело показало чистые полосы методом влажного переноса.

    Увеличить
    4

    проверено:
    Проверенный клиент

    WB Человек 12.08.2015

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Первичные эпителиальные клетки
    Виды Человек

    Блокировка

    Детали блокировки 5% молока в 0.1% TBST в течение 1 часа при комнатной температуре

    Первичное антитело

    Коэффициент разведения 1: 500, ночь при 4 градусах Цельсия в 5% молоке в 0,1% TBST

    Вторичные антитела

    Вторичное описание Козье антикроличье HRP
    Вторичный производитель Cat # KPL 0741516
    Вторичная концентрация 1: 5000

    Детали

    Примечания по обнаружению Хемилюминесценция, BioRad Universal Hood II, 10-минутная экспозиция

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 01.06.2015

    Сводка

    Блокировка BQ1

    Первичное антенное тело

    Вторичное антитело

    Приложение Вестерн-блот
    Образец протестирован Лизат клеток MDA-MB-231
    Виды Человек
    Лот
    Вторичное описание ослиный анти-кроличий IgG, HRP
    Вторичный номер по каталогу производителя Amersham NA934V
    Вторичная концентрация 1: 3000

    Детали

    Примечания к обнаружению BIO RAD ясность western ECL (специфичность антитела; не реагирует на сверхэкспрессию HIF1a, как показано на рисунке)
    4

    проверено:
    Проверенный клиент

    WB Человек 27.03.2015

    Сводка

    Приложение Вестерн-блот
    Образец протестирован Лизаты клеток 786O
    Виды Человек

    Блокировка

    Детали блокировки 5% молока в TBST

    Первичное антенное тело

    Вторичное антитело

    Вторичное описание Козье антикроличье
    Вторичная концентрация 1: 5000

    Детали

    Примечания по обнаружению с использованием обычного pico от pierece, обнаружение с помощью имидж-сканера Bio-rad, время экспозиции 2 мин, векторные клетки 786O — положительный контрольный результат.
    4

    проверено:
    Проверенный клиент

    ЧИП Человек 12.12.2014

    Сводка

    Приложение Иммунопреципитация хроматина
    Образец протестирован См. PMID: 24248342
    Виды Человек

    Подробности

    Примечания по обнаружению См. PMID: 24248342

    Комментарии

    Комментарии Опубликовано в PMID: 24248342
    4

    проверено:
    Проверенный клиент

    WB Человек 12.12.2014

    Сводка

    Приложение Вестерн-блот
    Образец протестирован См. PMID: 24308012
    Виды Человек

    Блокировка

    Детали блокировки См. PMID: 24308012

    Подробности

    Примечания к обнаружению Антитела работают хорошо, но требуется длительное время воздействия.

    Комментарии

    Комментарии Опубликовано в PMID: 24308012

    Увеличить
    4

    проверено:
    Xiuquan Luo

    WB Человек 12.09.2014

    Сводка

    Приложение Вестерн-блот
    Образец протестирован Лизат клеток HEK293
    Виды Человек

    Блокировка

    Блокирующие детали 1xPBST с 5% обезжиренным молоком, RT 1 час

    Первичное антитело

    Коэффициент разведения 1xPBST с 5% обезжиренным молоком, в течение ночи 4C, разведение 1: 1000

    Вторичные антитела

    75

    Детали

    Вторичное описание Козий анти-кроличий IgG-HRP
    Вторичный производитель № по каталогу sc-2004
    Вторичная концентрация Разведение 1: 2000
    Примечания по обнаружению Продолжительность воздействия ECL, выдержка в течение 2-5 мин

    Увеличить
    4

    проверено:
    Pramod Mallikarjuna

    WB Человек 30.08.2014

    Сводка

    Приложение Вестерн-блот
    Образец протестирован Образцы светлоклеточного почечно-клеточного рака
    Виды Человек

    Блокировка

    Блокирующие детали Блокирующий буфер Odyssey

    Первичное антенное тело

    Коэффициент разведения 1: 1000 в TBST, в течение ночи, +4 градуса Цельсия

    Вторичное антитело

    Вторичное описание IRDye® 800CW Goat anti-Rat IgG
    Вторичный номер по каталогу производителя 926-32219
    Вторичная концентрация 1: 10000
    9356
    Примечания по обнаружению Инфракрасная система визуализации Odyssey® CLx
    4

    проверено:
    Проверенный клиент

    WB Другое 26.07.2014

    Сводка

    Блокирование
    Заявка Вестерн-блот
    Образец протестирован Лизат цельных клеток PC12
    Виды Прочие
    Лот BR-1

    35

    Детали блокировки 5% молока в PBST в течение 1 часа при комнатной температуре

    Первичное антитело

    Коэффициент разведения 1: 1000 в 1% BSA в течение ночи при 4oC

    Вторичное антитело

    75

    Детали

    Вторичное описание Козий анти-кроличий IgG, HRP
    Вторичный производитель № по каталогу Сигнализация клеток № 7074
    Вторичная концентрация 1: 2000
    Примечания по обнаружению ECL, пленка экспонировалась в течение 5 секунд
    5

    проверено:
    Проверенный клиент

    WB Человек 30.06.2014

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Целоклеточный лизат
    Виды Человек

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 30.04.2014

    Сводка

    Заявка Вестерн-блот
    Образец протестирован лизат цельных клеток U87MG (клетки глиобластомы человека)
    Виды Человек

    Блокировка

    Детали блокировки 3% молоко / TBST, 1 час, комнатная температура

    Первичное антитело

    Коэффициент разведения 1: 1000 в 3% молоке / TBST, 2 часа, комнатная температура

    Вторичные антитела

    Вторичное описание козий анти-кроличий IgG, HRP
    Вторичный номер по каталогу производителя Dako
    Вторичная концентрация 1: 2000

    Детали

    Примечания по обнаружению ECL, рентгеновская пленка, экспозиция 1 час

    Увеличить
    4

    проверено:
    Saori Yoshii

    IHC-P Мышь 11.04.2014

    Сводка

    может быть обнаружен в ядре.Также обнаруживается фон в цитозоле (реальная полоса HIF-2a появлялась только в ядерной фракции, проверено WB).
    Приложение Иммуногистохимия-Парафин
    Образец протестирован Кишечник мыши
    Виды Мышь
    Лот

    Блокировка

    Детали блокировки Комплект Invitrogen HistoMouse

    Первичное антитело

    Коэффициент разведения x300 в 1% BSA

    Вторичное антитело

    Вторичное описание Комплект Invitrogen HistoMouse

    Детали

    Примечания по обнаружению DAB
    Сведения о фиксации + поиск антигена

    Комментарии

    Комментарии HIF-2a может быть обнаружен в ядре.Также обнаруживается фон в цитозоле (реальная полоса HIF-2a появлялась только в ядерной фракции, проверено WB).
    4

    проверено:
    Проверенный клиент

    WB Другое 04.04.2014

    Сводка

    Application Western Blot
    Образец протестирован SH-SY5Y лизат цельных клеток
    Виды Другое
    Lot BP-1
    Детали блокировки 5% молоко в PBST один час при комнатной температуре

    Первичное антитело

    Коэффициент разведения 1: 1000 в течение ночи при 4 ° C в 1% BSA в PBST

    Вторичное антитело

    75

    Подробные сведения

    Вторичное описание Козий анти-кроличий IgG, HRP
    Вторичный производитель Кат. № Сигнализация клеток № 7074
    Вторичная концентрация 1: 2000
    Примечания по обнаружению Субстрат Bio-rad Clarity Western ECL, экспозиция за одну минуту

    Увеличить
    5

    проверено:
    Проверенный клиент

    WB Человек 03.04.2014

    Сводка

    Заявка Вестерн-блот
    Виды Человек
    Лот BP-1

    Увеличить
    4

    проверено:
    Прабир Чакраборти

    WB Человек 24.01.2014

    Сводка

    Человеческий блок
    Заявка Вестерн-блот
    Образец протестирован НЕОБРАБОТАННЫЕ ЭПИТЕЛИЕВЫЕ КЛЕТКИ ПОВЕРХНОСТИ ЯИЧНИКА (OSE) И ЛИЗАТЫ КЛЕТОК A2780 25 мкг
    Детали блокировки 4% BSA IN TBST, 1Ч КОМНАТНАЯ ТЕМПЕРАТУРА

    Первичное антенное тело

    Коэффициент разведения 1: 750 В 4% BSA IN TBST ДЛЯ O / N AT 4 * C

    Вторичные антитела

    75

    Детали

    Вторичное описание Козий анти-кроличий IgG-HRP
    Вторичный производитель Кат. № sc-2301
    Вторичная концентрация 1: 10,000

    Увеличить
    4

    проверено:
    Проверенный клиент

    WB Человек 20.11.2013

    Сводка

    Блокирование
    Заявка Вестерн-блот
    Образец протестирован Клетки глиомы человека, лизаты целых клеток
    Виды Человеческий
    Лот 10 9356 BN-1
    Детали блокировки Молоко 5% в Tween TBS, 30 мин, 25 ° C

    Первичное антитело

    Коэффициент разбавления 1/500, 16 часов при 4 ° C в молоке 1% в TBS Tween 0.1%

    Вторичные антитела

    75

    Подробнее

    903
    Вторичное описание Козий анти-кроличий IgG (H + L)
    Вторичный производитель № по каталогу Bio-Rad
    Вторичная концентрация 1/10000

    Увеличить
    4

    проверено:
    Проверенный клиент

    IF Мышь 15.04.2013

    Сводка

    Приложение Иммунофлуоресценция
    Виды Мышь
    Pub Med ID 22753893
    Файл Просмотр PDF3

    Увеличить
    5

    проверено:
    Проверенный клиент

    ЧИП Крыса 02.04.2013

    Сводка

    Применение Иммунопреципитация хроматина
    Виды Крыса
    Особые применения Двуоденальный энтероцит крысы

    Увеличить
    4

    проверено:
    Проверенный клиент

    WB 19.09.2012

    Сводка

    Заявка Вестерн Блот
    Лот BK-2
    Pub Med ID 21288809
    Файл Открыть PDF3
    35
    5

    проверено:
    Проверенный клиент

    WB Мышь 08.12.2011

    Сводка

    Приложение Вестерн-блот
    Образец протестирован Мышь
    Виды Мышь

    Блокировка

    Детали блокировки 1 Буфер блокировки: 0% молока

    Первичное антенное тело

    Коэффициент разведения Коэффициент разведения: 1: 1000, Время инкубации: ночь, Температура инкубации: 4 градуса Цельсия

    Вторичные антитела

    Вторичное описание Коэффициент разбавления вторичного Ab: 1: 5000

    Детали

    Примечания по обнаружению Метод обнаружения: ECL

    Увеличить
    5

    проверено:
    Ольга Разоренова

    WB Человек 15.06.2011

    Сводка

    1 903
    Приложение Вестерн-блот
    Образец протестирован ACHN, SN12C, лизаты цельных клеток Caki1, Количество образца: 30 мкг
    Виды Человек
    Антитело в разведении 1: 500 обнаруживает HIF2 альфа с подходящей молекулярной массой (около 94 кДа) в клетках, подвергшихся гипоксии (0.5% O2, 16ч). Не нужно делать ядерные экстракты, это работает для экстрактов общего клеточного белка, также количество белка для дорожки должно быть 30-80 мкг. Обычно достаточно 30 мкг.

    Удачи !!!

    Pub Med ID 21233420

    Блокировка

    Сведения о блокировке Блокирующий буфер: 5% молока в PBST, время блокировки: 1 час, температура блокировки: комнатная температура

    Первичное антитело

    Коэффициент разведения Коэффициент разведения: 1: 500, Буфер для разведения инкубации: 5% молока в PBST, Время инкубации: ночь, Температура инкубации: 4 ° C

    Вторичные антитела

    Вторичное описание Вторичное антитело: анти-кроличий перфторпласт от Pierce, коэффициент разбавления вторичного антитела: 1: 5000
    Вторичный номер по каталогу производителя 31460

    Детали

    Примечания по обнаружению Метод: ECL, Время воздействия: 3 мин, Поз.Ctrl: лечение гипоксии, Neg.Ctrl: лечение нормоксии (21% O2), специфические диапазоны: 94 кДа

    Комментарии

    Комментарии Антитело в разведении 1: 500 обнаруживает HIF2 альфа с соответствующей молекулярной массой (около 94 кДа) в клетках, подвергшихся гипоксии (0,5% O2, 16 часов). Не нужно делать ядерные экстракты, это работает для экстрактов общего клеточного белка, также количество белка для дорожки должно быть 30-80 мкг.Обычно достаточно 30 мкг. Удачи!!!
    3

    проверено:
    Проверенный клиент

    WB Другое 11.03.2010

    Сводка

    3 AT был из ячеек РКО.Используя клетки HCT116, мы увидели несколько полос, но полоса 118 была определенно сильнее. Мы визуализируем вестерны с помощью Tyhpoon и ECL Plus. Мы обнаружили, что можем использовать больше разбавленных антител, чем когда мы использовали обычные ECL и пленку.
    Заявка Вестерн-блот
    Образец протестирован Линии клеток рака толстой кишки, Количество образца: 50 мкг
    Виды Прочие
    Лот

    Блокировка

    Детали блокировки Буфер блокировки: 5% Blotto, Время блокировки: 1 час, Температура блокировки: Комнатная температура

    Первичное антитело

    Коэффициент разведения Коэффициент разведения: 1/2000, буфер для разведения инкубации: 5% BSA в TNS с твином, время инкубации: ночь, температура инкубации: 4 ° C

    Вторичные антитела

    Вторичное описание Вторичное антитело: анти-кроличье, соотношение разведения вторичного антитела: 1/10000

    Детали

    Примечания по обнаружению Метод обнаружения: ECL Plus, определенные диапазоны: 118 кДа

    Комментарии

    Комментарии На изображении были клетки РКО.Используя клетки HCT116, мы увидели несколько полос, но полоса 118 была определенно сильнее. Мы визуализируем вестерны с помощью Tyhpoon и ECL Plus. Мы обнаружили, что можем использовать больше разбавленных антител, чем когда мы использовали обычные ECL и пленку.
    3

    проверено:
    Проверенный клиент

    WB Другое 09.02.2009

    Сводка

    Заявка Вестерн-блот
    Образец протестирован Клетки плоскоклеточного рака головы и шеи, Количество образца: 35 мкг
    Виды Другие

    Блокировка

    Блокирующие детали Блокирующий буфер: 5% обезжиренное сухое молоко в TBS-T, время блокировки: 1 час, температура блокировки: 25 градусов Цельсия

    Первичное антитело

    Коэффициент разведения Коэффициент разведения: 1/500, Буфер для разведения инкубации: 5% обезжиренное сухое молоко в TBS-T, Время инкубации: в течение ночи, Температура инкубации: 4 ° C

    Вторичные антитела

    Вторичное описание Вторичное Ab: поликлональная HRP кролика, Коэффициент разбавления вторичных Ab: 1/10000

    Подробности

    Примечания по обнаружению Метод обнаружения: ECL, Время экспозиции: варьируется, Поз.Ctrl: образец, обработанный гипоксией, Neg.Ctrl: нормоксия, удельные диапазоны: ~ 120 кДа
    3

    проверено:
    Проверенный клиент

    IHC-P Человек 02.02.2009

    Сводка

    Приложение Иммуногистохимия-парафин
    Образец протестирован меланома человека
    Виды Человеческий
    Лот , но относительно слабый AI 903Положительное окрашивание было цитоплазматическим в одних областях и ядерным в других. Антитела Novus NB100-480, которые должны работать только с WB, работали лучше, чем 100-122, при использовании с тем же протоколом на последовательной секции.

    Блокировка

    Блокирующие детали Блокирующий буфер: инактивированная нагреванием козья сыворотка в PBS, время блокирования: 30 минут, температура блокирования: комнатная температура

    Первичное антитело

    Коэффициент разведения Коэффициент разведения: 1/100, Буфер для разведения инкубации: блокирующий буфер, Время инкубации: в течение ночи, Температура инкубации: 4 ° C

    Вторичные антитела

    Вторичное описание Вторичное Ab: анти кроличий santa cruz
    Вторичный номер по каталогу производителя 1/200

    Комментарии

    Комментарии Окрашивание положительное, но относительно слабое.Положительное окрашивание было цитоплазматическим в одних областях и ядерным в других. Антитела Novus NB100-480, которые должны работать только с WB, работали лучше, чем 100-122, при использовании с тем же протоколом на последовательной секции.

    Ингибирование miR-122, опосредованное мРНК вируса гепатита B, активирует PTTG1-связывающий белок, который способствует росту опухоли гепатоцеллюлярной карциномы и клеточной инвазии функции печени и опухолевой трансформации.Наше предыдущее исследование показало, что уровни miR-122 значительно снижены у пациентов, инфицированных вирусом гепатита B (HBV), что может способствовать репликации и персистенции вируса (S. Wang, L. Qiu, X. Yan, W. Jin, Y. Wang , L. Chen, E. Wu, X. Ye, GF Gao, F. Wang, Y. Chen, Z. Duan и S. Meng, Hepatology

    55: 730–741, 2012). Потеря экспрессии miR-122 у пациентов с гепатитом B усиливает репликацию вируса гепатита B за счет модулированной циклином G1 активности P53.). В этом исследовании мы представляем доказательства того, что все мРНК HBV, несущие комплементарный сайт miR-122, действуют как губки для связывания и секвестрации эндогенного miR-122, что указывает на то, что высоко избыточные транскрипты HBV участвуют в опосредованном HBV супрессии miR-122.Затем мы идентифицировали фактор связывания (PBF) гена 1 трансформирующего опухоль гипофиза (PTTG1) в качестве мишени для miR-122 и продемонстрировали, что репликация HBV вызывает очевидное увеличение уровней PBF. Кроме того, мы наблюдали, что уровни miR-122 были снижены, а PBF активизировалась при хроническом гепатите B (CHB) и гепатоцеллюлярной карциноме (HCC). Исследования сверхэкспрессии и нокдауна показали, что PBF усиливает пролиферацию и инвазию клеток HCC, а подавление PBF приводит к резкому снижению роста опухоли HCC in vivo .Механистический анализ продемонстрировал, что PBF взаимодействует с PTTG1 и способствует ядерной транслокации PTTG1, впоследствии увеличивая его транскрипционную активность. Таким образом, мы идентифицировали новый регуляторный путь мРНК HBV-miR-122-PBF, который способствует росту злокачественных гепатоцитов и инвазии в CHB, что может способствовать развитию и прогрессированию HCC, вызванным CHB. Наша работа подчеркивает взаимное взаимодействие секвестрации и истощения миРНК хозяина вирусными мРНК, что может способствовать развитию рака, связанного с хронической инфекцией.

    ВВЕДЕНИЕ

    МикроРНК (miRNAs) представляют собой большое семейство небольших (~ 21 нуклеотид [nt]) некодирующих РНК, которые взаимодействуют с комплементарными сайтами-мишенями в своих мРНК-мишенях, чтобы вызвать репрессию трансляции, деаденилирование и деградацию (1). Однако реципрокный эффект мРНК-мишени на активность миРНК в значительной степени неизвестен. МикроРНК-122 (miR-122) является наиболее распространенной печеночно-специфической miRNA, составляющей примерно 70% от общей популяции miRNA в печени взрослого человека (2). Было обнаружено, что он играет ключевую роль в развитии и функции печени (3, 4), росте гепатоцитов, неопластической трансформации и канцерогенности (5-8), метаболизме липидов (9, 10) и регуляции вируса гепатита B (HBV). и репликация вируса гепатита С (ВГС) (11–13).

    HBV представляет собой небольшой (~ 3,2 т.п.н.) оболочечный частично двухцепочечный ДНК-вирус. Геном HBV содержит четыре перекрывающиеся открытые рамки считывания (ORF). Транскрипты РНК полиаденилированы; закрытый; 3,5, 2,4, 2,1 и 0,7 т.п.н. в длину; и назвали пре-C / C или пре-геномную РНК (пгРНК), пре-S, S и X мРНК соответственно. Эти мРНК кодируют несколько перекрывающихся вирусных белков, включая белки полимеразу, сердцевину, HBe, pre-S1, S2, S и X (14). Во всем мире насчитывается около 350 миллионов хронических носителей HBV, и хроническая инфекция HBV является основным этиологическим фактором гепатоцеллюлярной карциномы (ГЦК) (15, 16).Относительный риск развития ГЦК у пациентов с хроническим гепатитом В (ХГВ) оценивается в 25-100 раз выше, чем у пациентов без инфекции (15, 17, 18).

    Сообщалось о нескольких возможных путях и молекулярных механизмах участия инфекции HBV в злокачественной трансформации клеток печени, включая как прямые, так и косвенные механизмы, которые, вероятно, действуют синергетически. Прямые эффекты вирусных факторов включают интеграцию ДНК HBV в геном гепатоцитов (которая действует через цис — или транс -активацию соседних генов или усиливает хромосомную нестабильность хозяина), антиапоптотические и проканцерогенные функции HBx и усеченного пре-S2. / S вирусные белки, а также мутанты и генотипы HBV (14, 15, 19, 20).Косвенные эффекты хронической вирусной инфекции на злокачественную трансформацию включают стойкое воспаление и цирроз печени (которые могут вносить значительный вклад в трансформацию гепатоцитов и способствовать гепатоканцерогенезу посредством интегрированного многоступенчатого процесса [21, 22]), аберрантное метилирование ДНК конкретных клеточных генов (23). ) и восприимчивость хозяина (24). Однако молекулярные механизмы, лежащие в основе индуцированного HBV канцерогенеза, остаются неуловимыми и ждут дальнейшего изучения (14, 15).

    Наше предыдущее исследование показало, что потеря miR-122, вызванная инфекцией HBV, усиливает репликацию HBV за счет модулированной циклином G1 активности p53, тем самым, возможно, способствуя персистенции вируса (25). Более того, репрессия miR-122 обнаруживается только при ГЦК, возникающем в инфицированной HBV печени, но не в печени, инфицированной HCV (26). Основываясь на этих наблюдениях, мы стремились изучить, как инфекция HBV приводит к снижению miR-122 и вносит ли репрессия miR-122 вклад в развитие HCC у пациентов с ХГВ.В этом исследовании мы предоставляем экспериментальные доказательства того, что все четыре мРНК HBV несут комплементарный сайт miR-122, который может действовать как губка для связывания и секвестрации эндогенного miR-122. Кроме того, мы идентифицировали фактор связывания гена трансформации опухоли гипофиза (PTTG) (PBF; PTTG1IP) в качестве мишени для miR-122 и показали, что PBF участвует в регуляции пролиферации клеток рака печени, инвазии и роста опухоли. Таким образом, наши результаты раскрывают новый механизм, с помощью которого вирусные мРНК опосредуют активность миРНК хозяина и который способствует развитию рака, вызванного хронической инфекцией.

    МАТЕРИАЛЫ И МЕТОДЫ

    Пациенты и образцы людей.

    Образцы печени 23 пациентов с ХГВ и 19 HBV-инфицированных тканей печени пациентов, перенесших резекцию HCC, были собраны для анализа miR-122 и обнаружения мРНК HBV. Пациенты с хроническим гепатитом B определялись как пациенты с хронической инфекцией HBV с положительной реакцией на HBsAg в сыворотке крови в течение> 6 месяцев и, возможно, проявившие симптомы гепатита. Стандарт диагностики ГЦК подробно описан в другом месте (27).Кроме того, 10 контрольных нормальных тканей печени были получены из неиспользованных частей 10 донорской печени, использованных для трансплантации печени. Все пациенты были госпитализированы в Городскую инфекционную больницу Яньтая с января 2010 года по декабрь 2010 года. Клинические характеристики зачисленных субъектов перечислены в. Письменное информированное согласие было предоставлено всеми участниками исследования. Образцам пациентов был присвоен произвольный идентификатор в зависимости от порядка включения в наше исследование. Протокол исследования был одобрен этическим комитетом инфекционной больницы города Яньтай.

    Таблица 1

    Клиническая характеристика исследуемых субъектов

    . 23
    Параметр Значения по группам
    HC CHB HCC
    19
    Возраст (год; диапазон) 38 (28–53) 43 (30–55) 55 (40–77)
    Пол (мужской / женский) 7/3 17/6 16/3
    ALT (Ед / литр) 21 (15–30) 111 (43–226) 69 (26–190)
    HBeAg положительный (№[%]) ND 11 (48) 12 (63)
    Вирусная нагрузка HBV (копии ДНК / мл сыворотки [диапазон]) ND 9,3 × 10 6 (1,9 × 10 5 -8,0 × 10 7 ) 7,1 × 10 5 (2,1 × 10 2 -9,8 × 10 6 )
    Стадия HCC (I / II / III) ND ND 6/7/6

    Мыши.

    Трансгенных мышей BALB / c HBV (самки, возраст от 6 до 8 недель) были приобретены в лаборатории трансгенной инженерии, Центр инфекционных заболеваний, Гуанчжоу, Китай.Трансгенных мышей HBV получали с использованием конструкции вирусной ДНК, pHBV1.3, содержащей 1,3 копии генома HBV (генотип D). Все трансгенные мыши дали положительный результат на сывороточный поверхностный антиген HBV (HBsAg) и вирусную ДНК, а также на коровые белки HBV (HBcAg) в гепатоцитах их печени (28). Животные получали гуманный уход, а исследования на мышах проводились в строгом соответствии с правилами Института микробиологии Комитета по этике исследований Китайской академии наук. Протокол был одобрен Комитетом по этике исследований (номер разрешения PZIMCAS2011001).

    Плазмидные конструкции.

    Ген PTTG1 человека был клонирован в векторы pcDNA3.1 и pEGFP-C1 (Invitrogen), и рекомбинантные плазмиды были названы pPTTG1 и pEGFP-PTTG1 соответственно. Ген PBF человека был клонирован в вектор pcDNA3.1-Myc-His, и рекомбинантный вектор был назван pPBF. 3′-нетранслируемую область (UTR) PBF, содержащую сайт связывания miR-122, амплифицировали с помощью ПЦР с использованием следующих праймеров: смысловой, 5′-GCCCTCGAGCGTAAGGATACGTGGCTTTAGTA-3 ‘; антисмысловой, 5’-CCGGGATCCGTTTTATTGGAAACTGGTTA-3 ‘.Продукт ПЦР клонировали в сайты XhoI и BamHI вектора pEGFP-C1 (pEGFP-PBF-UTR). Мутации были сделаны в затравочной области сайта связывания miR-122 в 3’-UTR PBF (pEGFP-PBF-UTRm) для проверки предполагаемого сайта-мишени miR-122.

    Культура клеток и трансфекция.

    Клеточные линии гепатомы человека (Huh-7, HepG2 и SK-Hep-1) и линия иммортализованных клеток печени человека L02 были получены из АТСС (Манассас, Вирджиния). Химически синтезированный ингибитор miR-122 и неспецифический контроль, миметик miR-122 и неспецифический контроль и PBF-специфическая малая интерферирующая РНК (siRNA) были приобретены у RiboBio Co., Ltd. (Гуанчжоу, Китай). Трансфекцию проводили с использованием реагента Lipofectamine 2000 (Invitrogen). Клетки дважды промывали Opti-MEM (Invitrogen) и трансфицировали 50 нМ ингибитором miR-122, миметиком miR-122, миРНК PBF или 2 мкг экспрессионной плазмиды. Каждое лечение проводилось не менее трех раз.

    Извлечение РНК и ПЦР в реальном времени.

    Суммарную РНК экстрагировали из клеток или замороженных тканей с использованием реагента TRIzol (Invitrogen) в соответствии с инструкциями производителя. Количественную флуоресцентную ПЦР в реальном времени проводили с использованием реагента премикса SYBR green (TaKaRa Bio Inc., Сига, Япония). Глицеральдегид-3-фосфатдегидрогеназа (GAPDH) использовалась в качестве внутреннего стандарта для количественного определения. Анализ ПЦР в реальном времени для miR-122 выполняли с использованием набора TaqMan miRNA (Applied Biosystems). Для нормализации использовали эндогенный контроль U6. Первичный транскрипт miR-122 (pri-miR-122) детектировали с использованием набора для обратной транскрипции кДНК высокой емкости (Applied Biosystems) и анализа TaqMan pri-miRNA. Актин использовался в качестве гена внутреннего стандарта. Относительную экспрессию количественно оценивали с использованием метода сравнительного порогового цикла ( C T ).

    Люциферазный анализ.

    Регуляция транскрипции miR-122 с помощью HBV была проанализирована путем трансфекции линии клеток гепатомы человека (Huh-7) pHBV1.3, pGL-122 или pRL-TK в качестве контроля. Каждое лечение проводилось как минимум в трех экземплярах. Конструкция pGL-122 с репортерным геном люциферазы под промотором miR-122 была предоставлена ​​ShiMei Zhuang (Университет Сунь Ятсена, Китай) (8).

    Иммуногистохимия (ИГХ).

    Срезы ткани печени (толщиной 4 мкм) иммуноокрашивали с использованием специфического кроличьего поликлонального антитела к PBF (Santa Cruz Biotech) и вторичного антитела, конъюгированного с пероксидазой хрена (HRP), с использованием 3,3′-диаминобензидинтетрагидрохлорида (DAB) для визуализации. .Окрашивание PBF оценивали в соответствии со следующим подходом к оценке: не гиперэкспрессия, слабое слабое окрашивание цитоплазмы клеток; сверхэкспрессия, от умеренного до сильного окрашивания цитоплазмы в> 80% гепатоцитов.

    Вестерн-блоттинг.

    Вестерн-блоттинг выполняли, как описано ранее (29).

    Нозерн-блоттинг.

    Тотальную РНК (30 мкг) подвергали электрофорезу в 17% геле мочевины-ПААГ и переносили на нейлоновую мембрану. Мембрану сшивали УФ-излучением и предварительно гибридизовали при 37 ° C в течение 1 ч, а затем ее гибридизовали с зондом miR-122 или U6, меченным 32 P, при 37 ° C в течение ночи.Последовательность зонда miR-122 была полностью комплементарна miR-122 (5′-CAAACACCATTGTCACACTCCA-3 ‘), а последовательность зонда мяРНК U6 была 5′-GCAGGGGCCATGCTAATCTTCTCTGTATCG-3’. В конечном итоге мембраны были промыты и подвергнуты воздействию экранов PhosphorImager (GE Healthcare Bio-Sciences Corp.).

    Флуоресцентная микроскопия.

    Флуоресцентную микроскопию выполняли, как описано ранее (29).

    Анализ CCK-8.

    Эксперимент CCK-8 был проведен в соответствии с нашим предыдущим описанием (29).

    Анализ инвазии матригеля.

    Инвазионную активность in vitro клеточных линий гепатомы человека (HepG2, Huh-7 и SK-Hep-1) измеряли с использованием двухкамерной камеры Бойдена (Costar) и базальной мембраны Matrigel. После трансфекции (48 ч) 1 × 10 5 клеток высевали в верхнюю камеру вставки Transwell (поры 8 мкм), покрытой 1 мг / мл Matrigel (Collaborative Research Inc.). После 24-часового инкубационного периода немигрирующие клетки в верхней камере осторожно соскребали, а прилипшие клетки, присутствующие на нижней поверхности вставки, окрашивали 4 ‘, 6-диамидино-2-фенилиндолом (DAPI) и фотографировали с помощью флуоресцентная микроскопия.

    Создание стабильного трансфектанта shRNA.

    Были сконструированы три последовательности миРНК, нацеленные на ген PBF. Олигонуклеотиды были синтезированы и вставлены в вектор РНК-интерференция (RNAi) -pSIREN-RetroQ; конструкции короткой шпилечной РНК (shRNA) описаны в. Рекомбинантная плазмида была подтверждена секвенированием и обозначена как pSIREN-PBFi. Люцифераза кшРНК была выбрана в качестве фиктивного контроля трансфекции (pSIREN-Luci). Клетки Phoenix котрансфицировали pSIREN-PBFi или pSIREN-luci и вспомогательным вектором.После трансфекции (от 48 до 72 часов) супернатант собирали и клетки SK-Hep-1 инфицировали суспензией вируса. Через 48 часов после инфицирования клетки SK-Hep-1 помещали на отбор пуромицином (Ameresco) на 2 недели для создания стабильных клеточных линий shRNA SK-Hep-1-PBFi и SK-Hep-1-Luci. Уровни белка PBF определяли вестерн-блоттингом, чтобы подтвердить, что выбранные клоны содержат кшРНК.

    Таблица 2

    Олигонуклеотидные последовательности кшРНК PBF

    кшРНК PBF № Чувство Антисмысловые +
    1 5′- GATCCGGAGCTGCTTGTTCTCAGATTCAAGAGATCTGAGAACAAGCAGCTCCTTTTTTG -3 ‘ 5'- AATTCAAAAAAGGAGCTGCTTGTTCTCAGATCTCTTGAATCTGAGAACAAGCAGCTCCG -3′
    2 5′- GATCCCCGGCTTCCCTTTGTAAATTTCAAGAGAATTTACAAAGGGAAGCCGGTTTTTTG-3 5'- AATTCAAAAAACCGGCTTCCCTTTGTAAATTCTCTTGAAATTTACAAAGGGAAGCCGGG -3 ‘
    3 5′- GATCCCCGTATGCTAGATTTGAAATTCAAGAGATTTCAAATCTAGCATACGGTTTTTTG -3′ 5'- AATTCAAAAAACCGTATGCTAGATTTGAAATCTCTTGAATTTCAAATCTAGCATACGGG -3 ‘

    рост опухоли в иммунодефицитных мышей.

    Клетки SK-Hep-1-PBFi и SK-Hep-1-Luci в лог-фазе вводили подкожно (п / к) в правый бок самок мышей BALB / c-nu / nu в возрасте 5-6 недель ( 1 × 10 7 клеток / мышь, 5 мышей / группу). Мыши были получены из Института лабораторных зоотехник (CAMS & PUMC). Затем размер опухоли измеряли дважды в неделю. Через шесть недель после инъекции мышей скарифицировали, и все ксенотрансплантаты опухоли вырезали и взвешивали.

    Статистический анализ.

    Различия между группами определяли с использованием критерия Стьюдента t .Степень связи между переменными определялась непараметрической корреляцией Спирмена. P <0,05 считалось значимым.

    РЕЗУЛЬТАТЫ

    Подавление miR-122 репликацией HBV.

    На основании нашего предыдущего исследования, показывающего, что miR-122 специфически подавляется при ХГВ (25), мы исследовали возможные механизмы, лежащие в основе подавления индуцированного HBV-инфекцией miR-122. Что касается вирусных факторов, мы проверили, могут ли экспрессия и репликация HBV влиять на уровни miR-122 как in vitro , так и in vivo .Трансфекция плазмидой репликации HBV pHBV1.3 значительно снижает уровни miR-122 в клетках Huh-7 ( P <0,01) (). Чтобы подтвердить специфичность HBV в отношении подавления активности miR-122, мы также исследовали влияние экспрессии HBV на другие микроРНК, включая miR-21 и miR-181a, с помощью ПЦР в реальном времени. Результаты показали, что на уровни miR-21 и miR-181a не оказывала значительного влияния экспрессия HBV (). Затем использовали трансгенных мышей BALB / c, трансгенных HBV, чтобы определить, влияет ли репликация HBV непосредственно на уровни miR-122 in vivo .Трансгенные мыши HBV обычно иммунотолерантны к HBV, поскольку у этих мышей не наблюдается некровоспаления печени (28), что исключает возможное влияние воспаления печени на уровни miR-122. Было обнаружено, что у трансгенных мышей HBV уровень miR-122 в печени ниже, чем у мышей BALB / c (1,0 против 0,675 ± 0,06; P <0,05) (). Затем мы исследовали уровни экспрессии циклина G1, проверенной мишени miR-122 (6), в этой модели на животных. Результаты показали, что подавление miR-122 у трансгенных мышей HBV вызывает повышение уровней циклина G1 ().Взятые вместе, результаты предполагают, что снижение miR-122 при хронической инфекции HBV связано с репликацией вируса.

    Подавление miR-122 репликацией HBV. (A и B) После трансфекции вектором репликации HBV pHBV1.3 или пустой плазмидой pcDNA3.1 (фиктивная), экспрессия miR-122 (A) и экспрессия miR-21 и miR-181a (B) в Huh-7 количество клеток определяли с помощью ПЦР в реальном времени. Результаты были нормализованы к эндогенному контролю U6, RNU6B. (C и D) Обнаружение экспрессии miR-122 (C) и экспрессии циклина G1 (D) в печени мышей BALB / c, трансгенных по HBV ( n = 5) и контрольных мышей BALB / c ( n = 5 ) методом ПЦР в реальном времени. P <0,05 (*) и P <0,01 (**) по сравнению с контролем или имитацией лечения.

    мРНК HBV с дополнительным сайтом связывания с miR-122, секвестрирующая эндогенную miR-122.

    Чтобы понять, как репликация HBV подавляет уровни miR-122, мы сначала проверили, влияют ли вирусные факторы на транскрипцию miR-122. Репортерный анализ люциферазы проводили с использованием конструкции pGL-122, содержащей репортерный ген люциферазы под промотором miR-122 (8). Неожиданно трансфекция pHBV1.3 вызывал увеличение активности промотора miR-122 во все моменты времени (). Анализ ПЦР в реальном времени также выявил увеличение уровней первичного транскрипта miR-122 (pri-miR-122) после обработки pHBV1.3 (), подтверждая, что вирусная репликация действительно усиливает транскрипцию miR-122. Затем мы исследовали уровни экспрессии факторов транскрипции miR-122, включая HNF1α, HNF4α, HNF3β и C / EBPα (30). Как показано на фиг.1, уровни экспрессии HNF4α и C / EBPα увеличиваются после трансфекции pHBV1.3.

    Ингибирование miR-122 мРНК HBV.(A) Активность промотора miR-122 в ответ на трансфекцию pHBV1.3. Клетки Huh-7 котрансфицировали pHBV1.3 или пустым вектором pcDNA3.1 (ложная трансфекция), pGL-122 репортером люциферазы под промотором miR-122 и pRL-TK. Активность люциферазы pGL-122 и renilla измеряли с использованием набора для двойного люциферазного анализа в указанное время. (B) После трансфекции pHBV1.3 или pcDNA3.1 экспрессию pri-miR-122 в клетках Huh-7 количественно оценивали с помощью ПЦР в реальном времени. (C) Определение уровней мРНК факторов транскрипции miR-122 после трансфекции pHBV1.3 или pcDNA3.1 в течение 72 ч в клетках Huh-7. (D, вверху) Прогнозируемая связывающая последовательность miR-122, расположенная в геноме HBV в нуклеотидах с 1684 по 1709. Идеальные совпадения обозначены линией. Мутации производили в затравочной области сайтов связывания miR-122 (HBV-mut) без изменения аминокислотной последовательности X-белка. (Ниже) Предполагаемая комплементарная область miR-122 была обнаружена во всех четырех мРНК HBV. Клетки 293T котрансфицировали миметиком miR-122 или рандомизированным олигонуклеотидом (имитация трансфекции) и репортерной плазмидой люциферазы светлячка с 3′-UTR, содержащим либо дикого типа (HBV-wt), либо мутантный (HBV-mut) miR- 122 связывающая последовательность.Активность люциферазы светлячка и люциферазы рениллы измеряли с использованием набора для анализа двойной люциферазы. (E) Клетки Huh-7 трансфицировали плазмидой-репортером люциферазы либо 3′-UTR HBV-wt, либо HBV-mut, и уровни miR-122 измеряли с помощью ПЦР в реальном времени через 24 часа после трансфекции. (F и G) Клетки Huh-7 трансфицировали плазмидой HBV дикого типа (pHBV1.3-wt) или мутантной (pHBV1.3-mut) или pcDNA3.1 (ложная трансфекция). (F) Через 24 часа после трансфекции уровни miR-122 оценивали с помощью ПЦР в реальном времени (слева) и Нозерн-блоттинга (справа).(G) Экспрессия циклина G1 определялась через 48 часов вестерн-блоттингом. (H) Клетки Huh-7 трансфицировали pYMHD1.3 или pcDNA3.1, и через 24 часа после трансфекции уровни miR-122 измеряли с помощью ПЦР в реальном времени. (I) Клетки Huh-7 трансфицировали указанным количеством pHBV1,3, и уровни miR-122 и общие уровни мРНК HBV анализировали с помощью ПЦР в реальном времени. (J) Корреляционный анализ между уровнями miR-122 и внутрипеченочными уровнями мРНК HBV в CHB с помощью анализа Спирмена. Показаны значения коэффициента корреляции ( R ) и P . P <0,05 (*) и P <0,01 (**) по сравнению с ложной трансфекцией.

    Описанные выше данные показывают, что трансфекция pHBV1.3 привела к значительному снижению уровней зрелых miR-122, но очевидному увеличению транскрипции miR-122. Чтобы исследовать это несоответствие, мы предположили, что вызванное HBV уменьшение miR-122 происходит посттранскрипционно. Поскольку метод губки miRNA, то есть нацеливание на интересующую miRNA с помощью трансгена губки, имеющего несколько комплементарных сайтов miRNA, широко используется для исследований ингибирования miRNA (31), мы провели поиск предполагаемых сайтов связывания miR-122 в геномной последовательности HBV, используя Программное обеспечение Miranda.Предполагаемая комплементарная область miR-122 (охватывающая нуклеотиды от 1684 до 1709 в геноме HBV) была обнаружена во всех четырех мРНК HBV, включая пре-C / C (или pgRNA), pre-S, S 3′-UTR и X мРНК (). Мутации были сделаны в затравочной области сайта связывания miR-122 в качестве контроля. Этот сайт связывания miR-122 является высококонсервативным среди различных генотипов HBV (данные не показаны). Обработка миметиком miR-122 снижала репортерную активность репортера люциферазы, содержащего 3′-UTR HBV дикого типа (HBV-wt), но не мутантного (HBV-mut) ().

    Чтобы определить, может ли сайт связывания miR-122 в 3′-UTR HBV действовать как губка для ингибирования miR-122, клетки Huh-7 с постоянной высокой экспрессией miR-122 трансфицировали 3′-UTR HBV. -содержащий репортер люциферазы. Как показано на фиг.4, по сравнению с ложным контролем трансфекция 3′-UTR дикого типа, но не мутантной 3′-UTR, приводила к снижению уровней miR-122 ( P <0,05). Чтобы подтвердить, что сайт связывания miR-122 в гене HBV может приводить к ингибированию miR-122, вектор репликации HBV pHBV1.3 был мутирован в затравочной области связывания miR-122, как показано на. Как результаты ПЦР в реальном времени, так и результаты Нозерн-блоттинга продемонстрировали, что трансфекция плазмиды HBV дикого типа, но не мутантной, приводила к резкому снижению уровней miR-122 (), подтверждая, что сайты связывания miR-122 в мРНК HBV секвестрируют эндогенные miR- 122. Истощение miR-122 HBV было дополнительно подтверждено вестерн-блоттингом экспрессии мишени miR-122, циклина G1 (). Для дальнейшего подтверждения того, что уменьшение miR-122 является результатом прямой секвестрации miR-122 мРНК HBV, мотива YMDD в полимеразной последовательности pHBV1.3 был модифицирован до YMHD путем замены гистидина аспарагиновой кислотой в положении 540, и конструкция была названа pYMHD1.3. Мы обнаружили, что pYMHD1.3 все еще может ингибировать miR-122 (). Поскольку YMHD вместо YMDD в полимеразе приводит к снижению активности обратной транскриптазы и репликации HBV (32), эти данные предполагают, что мРНК HBV может непосредственно секвестировать miR-122. Более того, уменьшение miR-122 следовало кривой доза-ответ трансфекции плазмидой HBV дикого типа и было синхронизировано с увеличением общих уровней мРНК HBV ().Интересно, что трансфекция мутантной плазмидой HBV привела к увеличению уровней miR-122 по сравнению с уровнями пустой контрольной плазмиды (), что согласуется с наблюдениями (и) о том, что вирусные факторы фактически усиливают транскрипцию miR-122.

    Далее мы исследовали связь между уровнями miR-122 и внутрипеченочными уровнями общей мРНК HBV у пациентов с ХГВ. Как видно на фиг., Существует отрицательная корреляция между уровнями miR-122 и общими уровнями вирусной мРНК, что является дополнительным доказательством того, что вирусные мРНК приводят к супрессии miR-122.В совокупности эти результаты предполагают, что снижение уровней miR-122, индуцированное экспрессией и репликацией HBV, происходит за счет насыщения и истощения miR-122 через связывание с комплементарными сайтами связывания, расположенными в мРНК HBV.

    Между тем, другой предполагаемый сайт-мишень miR-122 также был обнаружен в прегеномной РНК вируса (охватывающий нуклеотиды с 2738 по 2760 в геноме HBV), но трансфекция репортера люциферазы 3′-UTR, содержащим эту область, не привела к снижение уровня miR-122.Кроме того, не было значительного различия уровней miR-122 в клетках Huh-7, трансфицированных плазмидами HBV дикого типа или мутантными (данные не показаны).

    Ингибирование miR-122 приводит к увеличению экспрессии его целевого PBF.

    Поскольку отчетливое подавление miR-122 наблюдалось в тканях печени пациентов с ХГВ и ГЦК (0,3541 ± 0,176 [ХГВ] по сравнению с 1 ± 0,0721 [HC], P = 0,014; 0,0821 ± 0,0286 [ГЦК] по сравнению с 1 ± 0,0721) [HC], P = 0,00058), и пациенты с HCC имели более низкие уровни miR-122, чем пациенты с CHB (0.3541 ± 0,176 [CHB] против 0,0821 ± 0,0286 [HCC], P = 0,11) (), затем мы исследовали мишени miR-122, которые могут играть роль в CHB-индуцированной HCC. 3′-UTR PBF был идентифицирован как предсказанная мишень для miR-122. Предполагаемая комплементарная область miR-122 в последовательности PTTG1IP (позиции 2202–2223 в 3′-UTR PTTG1IP) показана на. Мы обнаружили, что miR-122 ингибирует экспрессию зеленого флуоресцентного белка (GFP) дикого типа (EGFP-PBF-UTR), но не мутантного 3′-UTR (EGFP-PBF-UTRm) PBF в анализе репортера GFP.Клетки HepG2, Huh-7, L02 и SK-Hep-1, трансфицированные миметиком miR-122, демонстрировали снижение экспрессии PBF, в то время как ингибирование эндогенного miR-122 в клетках Huh-7 ингибитором miR-122 приводило к увеличение PBF (). Как и ожидалось, трансфекция плазмиды HBV вызвала очевидное увеличение уровней PBF в клетках Huh-7 ().

    PBF, мишень miR-122, активируется у пациентов с ХГВ и ГЦК. (A) Обнаружение экспрессии miR-122 в образцах биопсии печени из CHB, HCC (опухоль) и здоровых контролей (HC) с помощью ПЦР в реальном времени.Результаты были нормализованы к эндогенному контролю U6, RNU6B. Уровни miR-122 в HC были произвольно установлены на 1,0. (B, вверху) Идеальные совпадения обозначены линией между 3′-UTR PBF (PBF-UTR) и miR-122. Мутации (PBF-UTRm) были сделаны в затравочной области сайта связывания miR-122 для анализа репортерного гена. (Нижний) Клетки HepG2 котрансфицировали миметиком miR-122 или рандомизированным олигонуклеотидом в качестве ложной трансфекции и репортерной плазмидой EGFP, несущей либо плазмиду дикого типа (EGFP-PBF-UTR), либо мутант (EGFP-PBF-UTRm) 3 ‘. -UTR PBF.Уровни GFP измеряли с помощью вестерн-блоттинга. (C и D) Вестерн-блот-анализ экспрессии PBF в клетках HepG2, SK-Hep-1, Huh-7 и L02, трансфицированных миметиком или ингибитором miR-122 (C) или трансфицированных клетками дикого типа (pHBV1 .3-wt) и мутантный (pHBV1.3-mut) вектор репликации HBV (D). (E) Иммуногистохимический анализ экспрессии PBF в образцах печени из CHB, HCC и HC. (F) Распределение уровней miR-122 у пациентов с ХГВ с избыточной экспрессией и не гиперэкспрессией PBF в ткани печени.Данные выражаются в виде медиан и диапазонов (от 10-го до 90-го процентиля). *, P <0,05.

    Мы дополнительно исследовали уровни PBF в печени этих пациентов с помощью анализа IHC (). Сверхэкспрессия PBF наблюдалась у 39% больных ХГВ (9 из 23), 68% ГЦК (13 из 19) и ни у одного здорового человека (HC) (0/10). Отрицательная связь между уровнями miR-122 и сверхэкспрессией PBF была обнаружена у пациентов с ХГВ ( P <0,05) (). Вместе эти данные предполагают, что подавление miR-122, индуцированное CHB, увеличивает экспрессию его целевого PBF.

    PBF увеличивает пролиферацию и инвазивную способность клеток рака печени, а также способствует росту опухоли у мышей nude.

    Далее мы исследовали возможность того, что активация PBF в CHB может способствовать увеличению потенциала роста клеток гепатомы. Как видно на фиг.4, подавление экспрессии PBF с помощью siRNA снижает пролиферацию клеток Huh-7, тогда как избыточная экспрессия PBF после трансфекции вектора экспрессии pPBF приводит к увеличению пролиферации клеток ( P <0,001 или P <0.01). Аналогичные результаты наблюдались в клетках HepG2 () и SK-Hep-1 (). Впоследствии мы изучили, ингибирует ли miR-122 пролиферацию клеток через PBF. Трансфекция миметиком miR-122 значительно снижает пролиферацию клеток в клетках HepG2, но не в клетках, обработанных миРНК PBF (). Более того, истощение miR-122 его ингибитором привело к значительному увеличению пролиферации клеток в клетках Huh-7, но не в клетках, обработанных миРНК PBF (). Результаты показывают, что miR-122, по крайней мере, частично подавляет пролиферацию клеток посредством подавления PBF.Мы также обнаружили, что трансфекция pHBV1.3-wt увеличивала пролиферацию клеток Huh-7 (), тогда как трансфекция pHBV1.3-mut с мутациями в сайте связывания miR-122 не усиливала (). Примечательно, что эффект стимуляции роста HBV на клетках Huh-7 был почти устранен котрансфекцией miR-122 () или PBF siRNA (). Эти результаты предполагают, что HBV способствует пролиферации клеток за счет ингибирования miR-122 и последующей активации PBF.

    PBF усиливает рост раковых клеток печени. (От A до C) Клетки Huh-7 (A), HepG2 (B) и SK-Hep-1 (C) трансфицировали миРНК PBF (или контрольной миРНК в качестве имитации трансфекции) или вектором экспрессии PBF pPBF ( или pcDNA3.1-Myc-his как имитация трансфекции). Через 24, 48 и 72 часа после трансфекции рост клеток оценивали с помощью анализа CCK-8. (D и E) Клетки HepG2 трансфицировали миметиком miR-122 или рандомизированным олигонуклеотидом в качестве ложной трансфекции и миРНК PBF (D), а клетки Huh-7 трансфецировали ингибитором miR-122 или рандомизированным олигонуклеотидом и миРНК PBF. (E). Через 24, 48 и 72 часа после трансфекции рост клеток измеряли с помощью анализа CCK-8. (F к I) Клетки Huh-7 трансфицировали pHBV1.3-wt или pcDNA3.1 (F) или pHBV1.3-mut или pcDNA3.1 (G), или они были котрансфицированы pHBV1.3 или pcDNA3.1 вместе с миметиком miR-122 (H) или миРНК PBF (I). Через 24, 48 и 72 часа после трансфекции рост клеток измеряли с помощью анализа CCK-8. P <0,05 (*), P <0,01 (**) и P <0,001 (***) по сравнению с ложной трансфекцией.

    Затем мы исследовали влияние PBF на клеточную инвазию, используя анализ инвазии Matrigel (). Как показано на фиг.4, по сравнению с имитационной трансфекцией сверхэкспрессия PBF или PTTG1 путем трансфекции вектором pPBF или pPTTG1 в клетках Huh-7, HepG2 и SK-Hep-1 приводила к значительному увеличению инвазии через мембраны, покрытые матригелем.Примечательно, что инвазионная активность была значительно увеличена в клетках, котрансфицированных pPBF и pPTTG1, по сравнению с трансфекцией одним из них. Затем мы исследовали, увеличивает ли HBV инвазию клеток. Наши результаты показывают, что трансфекция pHBV1.3-wt (), но не pHBV1.3-mut () в клетках Huh-7 увеличивала инвазионную активность клеток. Более того, влияние HBV на клеточную инвазию было в значительной степени устранено одновременной трансфекцией miR-122 () или PBF siRNA (), что указывает на то, что HBV способствует инвазии, уменьшая miR-122 и увеличивая PBF.

    PBF усиливает инвазию раковых клеток печени. (A) Клетки Huh-7, HepG2 и SK-Hep-1 трансфицировали pPBF и / или pPTTG1 или pcDNA3.1-Myc-his (имитация трансфекции). Затем активность клеточной инвазии оценивали с помощью камеры Бойдена, покрытой матригелем. Репрезентативные изображения инвазивных клеток (окрашенных DAPI) были сфотографированы с помощью флуоресцентного микроскопа. (B) Показано среднее количество вторгшихся ячеек; результаты представлены как средние значения ± стандартное отклонение от трех независимых экспериментов.(C и D) Клетки Huh-7 трансфицировали pHBV1.3-wt или pcDNA3.1 (C) или pHBV1.3-mut или pcDNA3.1 (D). Затем была измерена способность к инвазии клеток и показано среднее количество инвазивных клеток. (E и F) Клетки Huh-7 котрансфицировали pHBV1.3 или pcDNA3.1 вместе с миметиком miR-122 (E) или миРНК PBF (F). Показано среднее количество вторгшихся ячеек. P <0,05 (*), P <0,01 (**) и P <0,001 (***) по сравнению с ложной трансфекцией.

    Кроме того, мы исследовали стимулирующую рост функцию PBF путем создания стабильной линии клеток SK-Hep-1, SK-Hep-1-PBFi () нокдауна PBF (). В соответствии с результатами in vitro , описанными выше, рост опухоли был значительно замедлен у голых мышей с ксенотрансплантатом SK-Hep-1-PBFi по сравнению с таковым у мышей, получавших имитацию (). Истощение PBF в клетках SK-Hep-1 привело к снижению веса опухоли на 65,6% ( P <0,05) (). Истощение PBF с помощью РНКи в опухолях было подтверждено обнаружением IHC ().Вместе эти результаты in vitro и in vivo демонстрируют опухолевые свойства PBF в клетках HCC и предполагают, что потеря miR-122 из-за экспрессии HBV и последующая повышающая регуляция его целевого PBF в CHB способствует развитию HCC.

    Эффект нокдауна PBF на рост опухоли печени у мышей nude. (A) Вестерн-блот-анализ экспрессии PBF в клетках SK-Hep-1, стабильно трансфицированных siRNA PBF (SK-Hep-1-PBFi) и клетках, трансфицированных люциферазой siRNA (SK-Hep-1-Luci), в качестве ложной трансфекции.Актин использовался в качестве контроля нагрузки. (B) SK-Hep-1-PBFi (PBF siRNA) или SK-Hep-1-Luci (имитация) клеток подкожно. вводили самкам мышей BALB / c-nu / nu. Диаметр опухоли измеряли дважды в неделю в течение 6 недель. (C) Вес опухоли измеряли, когда мышей умерщвляли на 6 неделе. Результаты представлены как средние значения ± стандартное отклонение для пяти мышей. (D) Парафиновые срезы опухолевой ткани окрашивали поликлональными антителами против PBF и окрашивали гематоксилином. *, P <0,05 по сравнению с имитацией лечения.Данные представляют два независимых эксперимента.

    PBF взаимодействует с PTTG1 и способствует его транскрипционной активности, облегчая ядерную транслокацию PTTG1.

    Известно, что PBF связан с PTTG1, который является протоонкогеном при эндокринном раке человека (33, 34). Таким образом, мы исследовали влияние PBF на субклеточную локализацию PTTG1. Как видно на фиг.4, в клетках HepG2 и Huh-7, трансфицированных вектором экспрессии pEGFP-PTTG1, PTTG1 локализуется как в ядре, так и в цитоплазме посредством иммунофлуоресценции (первый ряд), но он локализуется в ядре при котрансфекции вектором экспрессии pPBF (второй ряд).Чтобы дополнительно оценить, влияет ли взаимодействие между PBF и PTTG1 на функцию PTTG1 как активатора транскрипции, мы провели ПЦР-анализ в реальном времени экспрессии его генов-мишеней VEGF, FGF-2, c-myc и MMP-2 (35 ). Как показано на фиг.3, по сравнению с имитацией обработки уровни мРНК генов-мишеней транскрипции PTTG1 значительно увеличились в клетках, трансфицированных pPBF, и снизились в клетках, обработанных siRNA PBF. Вместе эти результаты демонстрируют, что PBF способствует транскрипционной активности PTTG1, облегчая транслокацию PTTG1 в ядро.

    PBF способствует транскрипционной активности PTTG1, облегчая ядерную транслокацию PTTG1. (A) Клетки HepG2 и Huh-7 котрансфицировали pEGFP-PTTG1 и pPBF или пустым вектором pcDNA3.1-Myc-His в качестве ложной трансфекции. Через 48 ч после трансфекции клетки фиксировали, и PTTG1 непосредственно определяли по зеленой флуоресценции. Окрашивание DAPI (синий) указывает на ядро. (B) Клетки HepG2 трансфицировали pPBF (или pcDNA3.1-Myc-his) или миРНК PBF (или контрольную миРНК). Через 48 часов после трансфекции уровни мРНК VEGF, FGF-2, Sp1, c-myc и MMP-2 измеряли с помощью ПЦР в реальном времени.Данные представлены в виде средних соотношений (± стандартное отклонение) по сравнению с таковыми для ложной трансфекции. Представлены результаты трех независимых экспериментов. P <0,05 (*), P <0,01 (**) и P <0,001 (***) по сравнению с ложной трансфекцией. (C) Схема того, как HBV-miR-122-PBF-PTTG1 может опосредовать рост и инвазию клеток печени. Ингибирование (⊥) или стимуляция (↓) определяли в соответствии с тем, как ХГВ влияет на экспрессию miR-122 и как miR-122 может способствовать развитию ГЦК.У пациентов с ХГВ miR-122 в гепатоцитах ингибируется вирусными мРНК и / или хроническим воспалением. Потеря экспрессии miR-122 приводит к усилению регуляции его целевого PBF, который инициирует ядерную транслокацию PTTG1, способствуя транскрипционной активности PTTG1 и, таким образом, усиливая рост и инвазию клеток. (D) мРНК HBV действуют как губки, блокируя опосредованное miR-122 ингибирование эндогенных генов-мишеней. В гепатоцитах без инфекции HBV мРНК-мишени miR-122 (черный) репрессируются комплексом miR-122 / RISC (зеленые прямоугольники).miR-122-индуцированная деградация мРНК-мишени показана черными пунктирными линиями. После инфицирования HBV вирусные мРНК (красные) экспрессируются на высоком уровне и секвестрируют комплексы miR-122, спасая экспрессию целевых мРНК.

    ОБСУЖДЕНИЕ

    Канцерогенез, связанный с HBV-инфекцией, представляет собой многофакторный и многоэтапный процесс с множеством этиологий, включающий множество генетических и эпигенетических изменений, а также дерегуляцию различных сигнальных путей в течение длительного латентного периода образования опухоли.Однако молекулярные механизмы, лежащие в основе ХГВ-индуцированной ГЦК, остаются в значительной степени дискуссионными (14–16). В настоящем исследовании мы исследовали клиническую и функциональную значимость высокоэкспрессированных мРНК HBV и печеночно-специфичных miR-122 для развития ГЦК при инфекции HBV. Мы обнаружили, что все четыре мРНК HBV содержат сайт связывания, который комплементарен miR-122 и может действовать как губка для связывания и секвестрации эндогенного miR-122, способствуя индуцированному HBV ингибированию miR-122. Кроме того, мы продемонстрировали, что подавление miR-122 ведет к увеличению экспрессии его целевого PBF, тем самым способствуя транскрипционной активности PTTG1 за счет облегчения его ядерной транслокации.Это, в свою очередь, способствует росту и инвазии клеток HCC и in vivo росту опухолей . В соответствии с нашими результатами, несколько других исследований (36, 37) также показывают, что miR-122 снижается в клетках, продуцирующих HBV, но механизм, с помощью которого это происходит, неизвестен. Таким образом, наши результаты дают первое представление об ингибировании miR-122 мРНК HBV и демонстрируют механизм роста и инвазии клеток, опосредованного HBV, путем активации PTTG1 посредством активации PBF-мишени miR-122, как показано на рис.Согласно этой модели, потеря miR-122 из-за секвестрации мРНК HBV может способствовать развитию HCC.

    Основным вкладом этой работы является демонстрация того, что сайт связывания miR-122 существует во всех четырех мРНК HBV и что во время инфекции HBV эти целевые мРНК miR-122 могут секвестировать эндогенный miR-122 в гепатоцитах, что, возможно, способствует снижению в miR-122 и активация его генов-мишеней, например PBF и циклина G1 (). Насколько нам известно, это первое сообщение о такой секвестрации и истощении миРНК вирусными мРНК при любой инфекции.

    Наблюдение за тем, что трансфекция плазмиды HBV усиливает транскрипцию miR-122, но приводит к уменьшению зрелой miR-122, привело нас к предположению, что miR-122 может секвестрироваться вирусными мРНК, подобно тому, как использовался метод губки miRNA. для исследований ингибирования miRNA путем экспрессии экзогенных РНК губок с множественными сайтами, комплементарными интересующей miRNA (31, 38). Эта гипотеза была подтверждена нашим открытием, что трансфекция репортера люциферазы 3′-UTR HBV дикого типа или плазмидой репликации HBV, несущей сайт связывания miR-122 (нуклеотиды с 1684 по 1709), приводила к снижению уровней miR-122, тогда как трансфекция мутантной 3′-UTR или плазмиды HBV не проводилась (и).Кроме того, уровни miR-122 отрицательно связаны с уровнями вирусной мРНК (и), подтверждая, что сайты связывания miR-122 в мРНК HBV секвестрируют эндогенный miR-122. Эти результаты согласуются с нашим предыдущим исследованием, показывающим, что уровни miR-122 отрицательно коррелируют с внутрипеченочной нагрузкой HBV при ХГВ (25). Несколько доказательств подтверждают нашу гипотезу. Предыдущие исследования (36, 37) показали, что miR-122 подавляется в экспрессирующей HBV клеточной линии HCC. Coulouarn et al. (26) показали, что miR-122 репрессируется в HBV-инфицированной, но не HCV-инфицированной HCC, указывая на то, что экспрессия miR-122 зависит от этиологии.О аналогичном результате сообщили Сарасин-Филипович и его коллеги, т. Е. Снижение уровней miR-122 наблюдается только у небольшой части пациентов с ВГС (39), что контрастирует с наблюдением, что почти все пациенты с ХГВ имеют гораздо более низкие уровни. miR-122 по сравнению со здоровым контролем. Следует отметить, что мы продемонстрировали, что уровни miR-122 могут быть значительно снижены за счет экспрессии HBV как in vitro , так и in vivo , тогда как очевидного изменения уровней miR-122 не наблюдалось в инфицированном HCV Huh7.5 ячеек (40). Однако, помимо мРНК HBV, 5′-UTR РНК HCV также может связываться с miR-122 (11, 13). Мы предполагаем, что это несоответствие связано с разным содержанием вирусной РНК между HBV и HCV, поскольку, согласно предыдущим исследованиям, количество копий РНК HBV на клетку достигает 10 5 (25, 41), тогда как для HCV количество копий РНК всего тысячи на ячейку (42). Учитывая, что miR-122 экспрессируется в гепатоцитах в количестве> 50000 копий на клетку (43) и обильная транскрипция HBV из вирусной ковалентно замкнутой кольцевой ДНК (cccDNA) в гепатоцитах, можно предположить, что большое количество вирусных мРНК, несущих miR-122 сайт связывания оказывает подавляющее действие на уровни miR-122, как у губок miR-122.Помимо сайтов связывания miR-122 (нуклеотиды с 1684 по 1709), которые мы идентифицировали во всех четырех мРНК HBV, другой сайт связывания miR-122 в вирусной пгРНК (нуклеотиды с 2738 по 2760) оказался мишенью для miR-122-. индуцированное ингибирование экспрессии гена HBV (36). Однако наше исследование показало, что этот сайт связывания miR-122 в pgRNA не приводит к значительному ингибированию miR-122. Это может быть связано с небольшой долей пгРНК по сравнению с общей вирусной мРНК. Это заслуживает дальнейшего исследования.

    Интересно, что мы также обнаружили, что прямое нацеливание мРНК HBV играет лишь незначительную роль в опосредованном miR-122 ингибировании репликации HBV (данные не показаны), что согласуется с нашим предыдущим исследованием, показывающим, что miR-122 в основном подавляет репликацию HBV. через активацию p53 (25).Возможная интерпретация состоит в том, что транскрипты HBV с высокой степенью избыточности продуцируются из вирусной кзкДНК в гепатоцитах (44). Таким образом, возможно, что потенциальное влияние miR-122 на репликацию HBV частично маскируется вирусными мРНК-губками, поскольку аналогичный феномен недавно наблюдался в рекомбинантном вирусе Коксаки, показывая, что вирус может преодолевать индуцированное микроРНК хозяина ингибирование за счет насыщения микроРНК. (30). Вероятно, взаимодействие между miR-122 и вирусными мРНК оказывает реципрокный эффект на уровни РНК HBV.Нацеливание мРНК HBV с помощью miR-122 может приводить к деградации и репрессии трансляции мРНК-мишени. Между тем, насыщение и истощение miR-122 через связывание с мРНК HBV увеличивает его целевой циклин G1, который может усиливать транскрипцию и экспрессию HBV с помощью пути p53 (25). Механизм, лежащий в основе miR-122-опосредованной регуляции вирусных мРНК, изучается.

    На сегодняшний день PBF является относительно не охарактеризованным онкобелком, функция которого остается в значительной степени неизвестной, хотя он повсеместно экспрессируется и высоко консервативен у широкого разнообразия видов животных.PBF сверхэкспрессируется при раке гипофиза, щитовидной железы и молочной железы и ассоциируется с плохим прогнозом (35, 45, 46), но не изучался в контексте ГЦК. Интересно, что повышенная экспрессия PTTG1 наблюдается по мере прогрессирования ХГВ до цирроза и ГЦК (47). Вероятно, PBF — не единственная мишень miR-122, которая имеет отношение к CHB-индуцированной HCC. Предыдущее исследование показало, что miR-122 играет важную роль в гепатоканцерогенезе, связанном с HBV, нацеливаясь на NDRG3, член семейства N-myc нижестоящих регулируемых генов (NDRG) (37).Кроме того, ранее мы также обнаружили, что целевой циклин G1 miR-122 сверхэкспрессируется в ХГВ (25). Тем не менее, в этом исследовании было показано, что стимулирующий эффект HBV на клеточную пролиферацию и инвазию в значительной степени зависит от регуляции miR-122 и PBF (и). Будет целесообразно изучить, как другие механизмы способствуют онкогенезу через мишени miR-122, такие как ADAM17 (7), SRF (5), Igf1R (8) и циклин G1 (6), в дополнение к NDRG3, и могут ли PBF сверхэкспрессия — обычная особенность HBV-ассоциированного HCC.

    Наконец, мы наблюдали более низкие уровни miR-122 в HBV-инфицированных HCC, чем в CHB, что не может быть связано исключительно с опосредованной мРНК HBV секвестрацией miR-122. Снижение экспрессии miR-122 как при HBV-инфицированном, так и при неинфицированном HCC, что связано с плохим прогнозом и метастазированием, было подтверждено несколькими другими исследованиями (5, 7, 8, 48). Таким образом, срочно необходимы механистические исследования для изучения причин снижения miR-122 при ГЦК.

    В заключение, наше текущее исследование обеспечивает новое понимание механизма насыщения и истощения miR-122 за счет связывания с комплементарными сайтами, расположенными в мРНК HBV.Кроме того, наши данные предполагают, что подавление miR-122 во время хронической инфекции HBV вызывает повышенную экспрессию его целевого PBF, что улучшает наше понимание молекулярных механизмов канцерогенеза, связанного с HBV. Таким образом, наша работа демонстрирует реципрокное взаимодействие секвестрации и истощения миРНК хозяина вирусными мРНК. Учитывая широкое взаимодействие микроРНК и их мРНК-мишеней при вирусных инфекциях, наши данные могут расширить знания о том, как вирусные факторы модулируют сигнальные пути клетки-хозяина с помощью множества механизмов, и предоставить обоснование для разработки новых методов лечения для предотвращения развития рака при хронических заболеваниях. вирусная инфекция.

    Нацеливание на мутации FLT3 в AML: обзор современных знаний и доказательств

  • 1.

    Ding L, Ley TJ, Larson DE, Miller CA, Koboldt DC, Welch JS, et al. Клональная эволюция при рецидиве острого миелоидного лейкоза, выявленная с помощью полногеномного секвенирования. Природа. 2012; 481: 506–10.

    CAS PubMed PubMed Central Google ученый

  • 2.

    Döhner H, Weisdorf DJ, Bloomfield CD. Острый миелоидный лейкоз. N Engl J Med.2015; 373: 1136–52.

    PubMed PubMed Central Google ученый

  • 3.

    Уолтер MJ, Payton JE, Ries RE, Shannon WD, Deshmukh H, Zhao Y, et al. Изменения количества приобретенных копий в геномах острого миелоидного лейкоза взрослых. Proc Natl Acad Sci USA. 2009. 106: 12950–5.

    CAS PubMed Google ученый

  • 4.

    Дёнер Х., Эстей Э, Гримуэйд Д., Амадори С., Аппельбаум Ф. Р., Бюхнер Т. и др.Диагностика и лечение ОМЛ у взрослых: рекомендации ELN, 2017 г., от международной группы экспертов. Кровь. 2017; 129: 424–47.

    PubMed PubMed Central Google ученый

  • 5.

    О’Доннелл М.Р., Таллман М.С., Аббуд С.Н., Альтман Дж. К., Аппельбаум Ф.Р., Арбер Д.А. и др. Острый миелоидный лейкоз, версия 3.2017, Руководство NCCN по клинической практике в онкологии. J Natl Compr Canc Netw. 2017; 15: 926–57.

    PubMed Google ученый

  • 6.

    Гримваде Д., Мрозек К. Диагностическое и прогностическое значение цитогенетики при остром миелоидном лейкозе. Hematol Oncol Clin North Am. 2011; 25: 61. vii

    Google ученый

  • 7.

    Арбер Д.А., Орази А., Хассерджян Р., Тиле Дж., Боровиц М.Дж., Ле Бо М.М. и другие. Пересмотр 2016 г. классификации миелоидных новообразований и острого лейкоза Всемирной организации здравоохранения. Кровь. 2016; 127: 2391–405.

    CAS PubMed Google ученый

  • 8.

    Schetelig J, Rollig C, Kayser S, Stoelzel F, Schaefer-Eckart K, Haenel M, et al. Валидация классификации ELN 2017 для AML с цитогенетикой промежуточного риска с мутациями NPM1 или без них и FLT3-ITD с высоким или низким соотношением. Кровь. 2017; 130: 2694.

    Google ученый

  • 9.

    Мутации Levis M. FLT3 при остром миелоидном лейкозе: какой подход лучше всего подходит в 2013 году? Образовательная программа Hematol Am Soc Hematol. 2013; 2013: 220–6.

    Google ученый

  • 10.

    Дёнер Х., Эстей Э., Амадори С., Аппельбаум Ф. Р., Бюхнер Т., Бернетт А. К. и др. Диагностика и лечение острого миелоидного лейкоза у взрослых: рекомендации международной группы экспертов от имени European LeukemiaNet. Кровь. 2010; 115: 453–74.

    PubMed Google ученый

  • 11.

    Grunwald MR, Tseng LH, Lin MT, Pratz KW, Eshleman JR, Levis MJ, et al. Улучшенный анализ ПЦР с внутренней тандемной дупликацией FLT3 позволяет прогнозировать исход острого миелоидного лейкоза после аллогенной трансплантации.Пересадка костного мозга Biol. 2014; 20: 1989–95.

    CAS PubMed PubMed Central Google ученый

  • 12.

    Лин Т.Л., Уильямс Т., Хе Дж., Алджитави О.С., Гангули С., Абхьянкар С. и др. Нормы полного диагностического обследования пациентов с острым миелоидным лейкозом. Cancer Med. 2015; 4: 519–22.

    PubMed PubMed Central Google ученый

  • 13.

    Джордж Т.И., Творек Дж. А., Томас Н. Э., Фатери Л. А., Соуэрс Р. Дж., Наклех Р. Э. и др.Оценка тестирования образцов острого лейкоза: результат опроса Коллегии американских патологов. Arch Pathol Lab Med. 2017; 141: 1101–6.

    CAS PubMed Google ученый

  • 14.

    Grafone T, Palmisano M, Nicci C, Storti S. Обзор роли рецептора FLT3-тирозинкиназы в остром миелоидном лейкозе: биология и лечение. Oncol Rev.2012; 6: e8.

    PubMed PubMed Central Google ученый

  • 15.

    Kottaridis PD, Gale RE, Linch DC. Мутации Flt3 и лейкемия. Br J Haematol. 2003. 122: 523–38.

    CAS PubMed Google ученый

  • 16.

    Нагель Г., Вебер Д., Фромм Э., Эрхард С., Любберт М., Фидлер В. и др. Эпидемиологическая, генетическая и клиническая характеристика по возрасту впервые диагностированного острого миелоидного лейкоза на основе академического популяционного регистрационного исследования (AMLSG BiO). Ann Hematol. 2017; 96: 1993–2003.

    PubMed PubMed Central Google ученый

  • 17.

    Уитмен С.П., Арчер К.Дж., Фенг Л., Балдус К., Бекнелл Б., Карлсон Б.Д. и др. Отсутствие аллеля дикого типа предсказывает плохой прогноз у взрослых de novo острого миелоидного лейкоза с нормальной цитогенетикой и внутренней тандемной дупликацией FLT3: исследование рака и лейкемии группы B. Cancer Res. 2001; 61: 7233–9.

    CAS PubMed Google ученый

  • 18.

    Thiede C, Steudel C, Mohr B., Schaich M, Schakel U, Platzbecker U, et al. Анализ мутаций, активирующих FLT3, у 979 пациентов с острым миелогенным лейкозом: ассоциация с подтипами FAB и определение подгрупп с плохим прогнозом.Кровь. 2002; 99: 4326–35.

    CAS PubMed Google ученый

  • 19.

    Халед С., Аль Малки М., Маркучи Г. Острый миелоидный лейкоз: биологические, прогностические и терапевтические идеи. Онкология (Уиллистон-Парк). 2016; 30: 318–29.

    PubMed Google ученый

  • 20.

    Kottaridis PD, Gale RE, Langabeer SE, Frew ME, Bowen DT, Linch DC. Исследования мутаций FLT3 в парных представлениях и образцах рецидивов от пациентов с острым миелоидным лейкозом: значение мутации FLT3 в лейкемогенезе, выявление минимального остаточного заболевания и возможная терапия ингибиторами FLT3.Кровь. 2002; 100: 2393–8.

    CAS PubMed Google ученый

  • 21.

    Shih LY, Huang CF, Wu JH, Lin TL, Dunn P, Wang PN и др. Внутренняя тандемная дупликация FLT3 при рецидиве острого миелоидного лейкоза: сравнительный анализ образцов костного мозга от 108 взрослых пациентов при диагностике и рецидиве. Кровь. 2002; 100: 2387–92.

    CAS PubMed Google ученый

  • 22.

    Кронке Дж., Буллингер Л., Телеану В., Чурц Ф., Гайдзик В.И., Кун М.В. и др. Клональная эволюция при рецидивирующем остром миелоидном лейкозе с мутацией NPM1. Кровь. 2013; 122: 100–8.

    PubMed Google ученый

  • 23.

    Метзелер К.Х., Герольд Т., Ротенберг-Терли М., Амлер С., Зауэрланд М.К., Горлих Д. и др. Спектр и прогностическая значимость мутаций гена-водителя при остром миелоидном лейкозе. Кровь. 2016; 128: 686–98.

    CAS PubMed Google ученый

  • 24.

    Папаэммануил Э., Герстунг М., Буллингер Л., Гайдзик В.И., Пашка П., Робертс Н.Д. и др. Геномная классификация и прогноз при остром миелоидном лейкозе. N Engl J Med. 2016; 374: 2209–21.

    CAS PubMed PubMed Central Google ученый

  • 25.

    Смит С.К., Ван К., Чин С.С., Салерно С., Дэймон Л.Е., Левис М.Дж. и др. Валидация мутаций ITD в FLT3 в качестве терапевтической мишени при остром миелоидном лейкозе человека. Природа. 2012; 485: 260–3.

    CAS PubMed PubMed Central Google ученый

  • 26.

    Cortes JE, Kantarjian HM, Kadia TM, Borthakur G, Konopleva M, Garcia-Manero G. et al. Креноланиба безилат, ингибитор пан-FLT3 типа I, для демонстрации клинической активности при множественном рецидиве FLT3-ITD и D835 AML. J Clin Oncol. 2016; 34: 7008

    Google ученый

  • 27.

    Кортес Дж., Перл А.Е., Дёнер Х., Кантарджиан Х., Мартинелли Дж., Ковачович Т. и др.Квизартиниб, ингибитор FLT3, в качестве монотерапии у пациентов с рецидивирующим или рефрактерным острым миелоидным лейкозом: открытое многоцентровое исследование фазы 2 в одной группе. Ланцет Онкол. 2018; 19: 889–903.

    CAS PubMed Google ученый

  • 28.

    Cortes JE, Tallman MS, Schiller GJ, Trone D, Gammon G, Goldberg SL, et al. Фаза 2b: исследование двух режимов дозирования монотерапии хизартинибом у пациентов с мутированным, рецидивным или рефрактерным AML в FLT3 FLT3 -ITD.Кровь. 2018; 132: 598–607.

  • 29.

    Perl AE, Altman JK, Cortes J, Smith C, Litzow M, Baer MR, et al. Селективное ингибирование FLT3 гильтеритинибом при рецидивирующем или рефрактерном остром миелоидном лейкозе: многоцентровое открытое исследование, проводимое впервые на людях, фаза 1-2. Ланцет Онкол. 2017; 18: 1061–75.

    CAS PubMed PubMed Central Google ученый

  • 30.

    Randhawa JK, Kantarjian HM, Borthakur G, Thompson PA, Konopleva M, Daver N, et al.Результаты исследования фазы II креноланиба у пациентов с рецидивирующим / рефрактерным острым миелоидным лейкозом (Pts) с активирующими мутациями FLT3. Кровь. 2014; 124: 389.

    Google ученый

  • 31.

    Stone RM, DeAngelo DJ, Klimek V, Galinsky I., Estey E, Nimer SD, et al. Пациенты с острым миелоидным лейкозом и активирующей мутацией в FLT3 реагируют на низкомолекулярный ингибитор тирозинкиназы FLT3, PKC412. Кровь. 2005; 105: 54–60.

    CAS PubMed Google ученый

  • 32.

    Бортакур Г., Кантарджиан Х., Раванди Ф., Чжан В., Коноплева М., Райт Дж. Дж. И др. Фаза I исследования сорафениба у пациентов с рефрактерными или рецидивирующими острыми лейкозами. Haematologica. 2011; 96: 62–8.

    CAS PubMed Google ученый

  • 33.

    Stone RM, Fischer T., Paquette R, Schiller G, Schiffer CA, Ehninger G, et al. Исследование фазы IB ингибитора киназы FLT3 мидостаурина в сочетании с химиотерапией у молодых недавно диагностированных взрослых пациентов с острым миелоидным лейкозом.Лейкемия. 2012; 26: 2061–8.

    CAS PubMed PubMed Central Google ученый

  • 34.

    Раванди Ф., Арана ЙиК, Кортес Дж. Э., Левис М., Фадерл С., Гарсия-Манеро Дж. И др. Заключительный отчет фазы II исследования сорафениба, цитарабина и идарубицина для начальной терапии у более молодых пациентов с острым миелоидным лейкозом. Лейкемия. 2014; 28: 1543–5.

    CAS PubMed PubMed Central Google ученый

  • 35.

    Кийой Х., Наое Т., Накано Й., Йокота С., Минами С., Мияваки С. и др. Прогностическое значение мутаций генов FLT3 и N-RAS при остром миелоидном лейкозе. Кровь. 1999; 93: 3074–80.

    CAS PubMed Google ученый

  • 36.

    Kottaridis PD, Gale RE, Frew ME, Harrison G, Langabeer SE, Belton AA, et al. Наличие внутренней тандемной дупликации FLT3 у пациентов с острым миелоидным лейкозом (AML) добавляет важную прогностическую информацию в группу цитогенетического риска и ответ на первый цикл химиотерапии: анализ 854 пациентов из исследований AML 10 и 12 Совета медицинских исследований Соединенного Королевства .Кровь. 2001; 98: 1752–9.

    CAS PubMed Google ученый

  • 37.

    Порт M, Bottcher M, Thol F, Ganser A, Schlenk R, Wasem J и др. Прогностическое значение внутренней тандемной дупликации FLT3, мутаций нуклеофозмина 1 и CEBPA для пациентов с острым миелоидным лейкозом с нормальным кариотипом и моложе 60 лет: систематический обзор и метаанализ. Ann Hematol. 2014; 93: 1279–86.

    CAS PubMed Google ученый

  • 38.

    Bacher U, Haferlach C, Kern W, Haferlach T, Schnittger S. Прогностическая значимость мутаций FLT3-TKD в AML: комбинация имеет значение — анализ 3082 пациентов. Кровь. 2008; 111: 2527–37.

    CAS PubMed Google ученый

  • 39.

    Шленк Р.Ф., Кайзер С., Буллингер Л., Коббе Г., Каспер Дж., Рингхоффер М. и др. Дифференциальное влияние аллельного отношения и сайта инсерции в FLT3-ITD-положительном AML по отношению к аллогенной трансплантации.Кровь. 2014; 124: 3441–9.

    CAS PubMed Google ученый

  • 40.

    Linch DC, Hills RK, Burnett AK, Khwaja A, Gale RE. Влияние уровня мутантного аллеля FLT3 (ITD) на риск рецидива при остром миелоидном лейкозе промежуточного риска. Кровь. 2014; 124: 273–6.

    CAS PubMed Google ученый

  • 41.

    Stone RM, Mandrekar SJ, Sanford BL, Laumann K, Geyer S, Bloomfield CD, et al.Мидостаурин плюс химиотерапия острого миелоидного лейкоза с мутацией FLT3. N Engl J Med. 2017; 377: 454–64.

    CAS PubMed PubMed Central Google ученый

  • 42.

    Стируолт Д.Л., Копецки К.Дж., Мешинчи С., Энгель Дж. Х., Погосова-Агаджанян Е.Л., Линсли Дж. И др. Размер внутренней тандемной дупликации FLT3 имеет прогностическое значение у пациентов с острым миелоидным лейкозом. Кровь. 2006; 107: 3724–6.

    CAS PubMed PubMed Central Google ученый

  • 43.

    Kayser S, Schlenk RF, Londono MC, Breitenbuecher F, Wittke K, Du J и др. Вставка внутренней тандемной дупликации FLT3 в домен тирозинкиназы-1 связана с устойчивостью к химиотерапии и плохим исходом. Кровь. 2009; 114: 2386–92.

    CAS PubMed Google ученый

  • 44.

    Лю С.Б., Донг Х.Дж., Бао ХБ, Цю КК, Ли ХЗ, Шэнь Х.Дж. и др. Влияние длины FLT3-ITD на прогноз острого миелоидного лейкоза. Haematologica.2019; 104: e9 – e12.

    PubMed Google ученый

  • 45.

    Cloos J, Goemans BF, Hess CJ, van Oostveen JW, Waisfisz Q, Corthals S, et al. Стабильность и прогностическое влияние мутаций FLT3 в парных исходных и рецидивирующих образцах ОМЛ. Лейкемия. 2006; 20: 1217–20.

    CAS PubMed Google ученый

  • 46.

    Маккормик С.Р., Маккормик М.Дж., Груткоски П.С., Дакер Г.С., Банерджи Н., Хиггинс Р.Р. и др.Мутации FLT3 при диагностике и рецидиве острого миелоидного лейкоза: цитогенетические и патологические корреляции, включая морфологию чашеобразного взрыва. Arch Pathol Lab Med. 2010; 134: 1143–51.

    PubMed Google ученый

  • 47.

    Нажа А., Кортес Дж., Фадерл С., Пирс С., Дэвер Н., Кадиа Т. и др. Активация внутренних тандемных дупликационных мутаций fms-подобной тирозинкиназы-3 (FLT3-ITD) при полном ответе и рецидиве у пациентов с острым миелоидным лейкозом.Haematologica. 2012; 97: 1242–5.

    CAS PubMed PubMed Central Google ученый

  • 48.

    Пратц К.В., Сато Т., Мерфи К.М., Стайн А., Райкхова Т., Левис М. Аллельная нагрузка мутантного FLT3 и клинический статус являются прогностическими факторами ответа на ингибиторы FLT3 при ОМЛ. Кровь. 2010; 115: 1425–32.

    CAS PubMed PubMed Central Google ученый

  • 49.

    Уоррен М., Лутра Р., Инь С.К., Раванди Ф., Кортес Дж. Э., Кантарджиан Х. М. и др.Клинические последствия изменения статуса мутации FLT3 у пациентов с острым миелолейкозом. Мод Pathol. 2012; 25: 1405–12.

    CAS PubMed Google ученый

  • 50.

    Ваттад М., Вебер Д., Дёнер К., Краутер Дж., Гайдзик В.И., Пашка П. и др. Влияние схем спасения на ответ и общую выживаемость при остром миелоидном лейкозе с отказом индукции. Лейкемия. 2017; 31: 1306–13.

    CAS PubMed Google ученый

  • 51.

    Schlenk RF, Frech P, Weber D, Brossart P, Horst HA, Kraemer D, et al. Влияние характеристик до лечения и стратегии спасения на исход у пациентов с рецидивом острого миелоидного лейкоза. Лейкемия. 2017; 31: 1217–20.

    CAS PubMed PubMed Central Google ученый

  • 52.

    Оран Б., Кортес Дж., Бейтинджане А., Чен Х.С., де Лима М., Патель К. и др. Аллогенная трансплантация в первой ремиссии улучшает исходы независимо от соотношения аллелей FLT3-ITD при FLT3-ITD-положительном остром миелогенном лейкозе.Пересадка костного мозга Biol. 2016; 22: 1218–26.

    CAS PubMed PubMed Central Google ученый

  • 53.

    Ho AD, Schetelig J, Bochtler T., Schaich M, Schafer-Eckart K, Hanel M, et al. Трансплантация аллогенных стволовых клеток улучшает выживаемость пациентов с острым миелоидным лейкозом, характеризующимся высоким аллельным соотношением мутантного FLT3-ITD. Пересадка костного мозга Biol. 2016; 22: 462–9.

    CAS PubMed Google ученый

  • 54.

    Гайдзик В.И., Телеану В., Папаэммануил Э., Вебер Д., Пашка П., Хан Дж. И др. Мутации RUNX1 при остром миелоидном лейкозе связаны с различными клинико-патологическими и генетическими особенностями. Лейкемия. 2016; 30: 2160–8.

    CAS PubMed Google ученый

  • 55.

    Бадар Т., Кантарджиан Х.М., Ногерас-Гонсалес Г.М., Бортакур Дж., Гарсия Манеро Г., Андрефф М. и др. Улучшение клинических исходов у пациентов с острым миелоидным лейкозом с мутацией FLT3 ITD за последние полтора десятилетия.Am J Hematol. 2015; 90: 1065–70.

    CAS PubMed PubMed Central Google ученый

  • 56.

    Зарринкар П.П., Гунавардане Р.Н., Крамер М.Д., Гарднер М.Ф., Бригам Д., Белли Б. и др. AC220 — это уникальный мощный и селективный ингибитор FLT3 для лечения острого миелоидного лейкоза (AML). Кровь. 2009; 114: 2984–92.

    CAS PubMed PubMed Central Google ученый

  • 57.

    Hills RK, Gammon G, Trone D, Burnett AK. Квизартиниб значительно улучшает общую выживаемость у FLT3-ITD-положительных пациентов с ОМЛ, у которых возник рецидив после трансплантации стволовых клеток или после неудачной химиотерапии спасения: сравнение с исторической базой данных ОМЛ (данные UK NCRI). Кровь. 2015; 126: 2557.

    Google ученый

  • 58.

    Wander SA, Levis MJ, Fathi AT. Возрастающая роль ингибиторов FLT3 при остром миелоидном лейкозе: хизартиниб и другие.Ther Adv Hematol. 2014; 5: 65–77.

    CAS PubMed PubMed Central Google ученый

  • 59.

    Смит Б.Д., Левис М., Беран М., Джайлс Ф., Кантарджиан Х., Берг К. и др. Одноместный агент CEP-701, новый ингибитор FLT3, проявляет биологическую и клиническую активность у пациентов с рецидивирующим или рефрактерным острым миелоидным лейкозом. Кровь. 2004. 103: 3669–76.

    CAS PubMed Google ученый

  • 60.

    Pratz KW, Cortes J, Roboz GJ, Rao N, Arowojolu O, Stine A, et al. Фармакодинамическое исследование ингибитора FLT3 KW-2449 дает представление об основе клинического ответа. Кровь. 2009. 113: 3938–46.

    CAS PubMed PubMed Central Google ученый

  • 61.

    Фидлер В., Кайзер С., Кебенко М., Яннинг М., Краутер Дж., Шиттенхельм М. и др. Исследование фазы I / II сунитиниба и интенсивной химиотерапии у пациентов старше 60 лет с острым миелоидным лейкозом и активирующими мутациями FLT3.Br J Haematol. 2015; 169: 694–700.

    CAS PubMed Google ученый

  • 62.

    Rollig C, Serve H, Huttmann A, Noppeney R, Muller-Tidow C, Krug U, et al. Добавление сорафениба по сравнению с плацебо к стандартной терапии у пациентов в возрасте 60 лет и младше с впервые диагностированным острым миелоидным лейкозом (SORAML): многоцентровое, фаза 2, рандомизированное контролируемое исследование. Ланцет Онкол. 2015; 16: 1691–9.

    PubMed Google ученый

  • 63.

    Левис М., Раванди Ф., Ван Э.С., Баер М.Р., Перл А, Кутре С. и др. Результаты рандомизированного исследования спасительной химиотерапии с последующим лечением лестуртинибом у пациентов с мутантным ОМЛ FLT3 при первом рецидиве. Кровь. 2011; 117: 3294–301.

    CAS PubMed PubMed Central Google ученый

  • 64.

    Knapper S, Russell N, Gilkes A, Hills RK, Gale RE, Cavenagh JD, et al. Рандомизированная оценка добавления ингибитора киназы лестуртиниба к химиотерапии первой линии при ОМЛ с мутацией FLT3.Кровь. 2017; 129: 1143–54.

    CAS PubMed PubMed Central Google ученый

  • 65.

    Fiedler W., Serve H, Döhner H, Schwittay M, Ottmann OG, O’Farrell AM, et al. Исследование SU11248 фазы 1 для лечения пациентов с рефрактерным или резистентным острым миелоидным лейкозом (AML) или пациентов, не поддающихся традиционной терапии этого заболевания. Кровь. 2005; 105: 986–93.

    CAS PubMed Google ученый

  • 66.

    Serve H, Krug U, Wagner R, Sauerland MC, Heinecke A, Brunnberg U, et al. Сорафениб в сочетании с интенсивной химиотерапией у пожилых пациентов с острым миелоидным лейкозом: результаты рандомизированного плацебо-контролируемого исследования. J Clin Oncol. 2013; 31: 3110–8.

    CAS PubMed Google ученый

  • 67.

    Раванди Ф., Алаттар М.Л., Грюнвальд М.Р., Рудек М.А., Райкхова Т., Ричи М.А. и др. Фаза 2 исследования комбинации азацитидин плюс сорафениб у пациентов с острым миелоидным лейкозом и внутренней тандемной дупликационной мутацией FLT-3.Кровь. 2013; 121: 4655–62.

    CAS PubMed PubMed Central Google ученый

  • 68.

    Чен Й.Б., Ли С., Лейн А.А., Коннолли С., Дель Рио С., Валлес Б. и др. Фаза I испытания поддерживающего сорафениба после трансплантации аллогенных гемопоэтических стволовых клеток для внутренней тандемной дупликации fms-подобной тирозинкиназы 3 при остром миелоидном лейкозе. Пересадка костного мозга Biol. 2014; 20: 2042–8.

    CAS PubMed PubMed Central Google ученый

  • 69.

    Фишер Т., Стоун Р.М., Деанджело Д.Д., Галински И., Эстей Э, Ланза С. и др. Испытание фазы IIB перорального мидостаурина (PKC412), FMS-подобного рецептора тирозинкиназы 3 (FLT3) и многоцелевого ингибитора киназы у пациентов с острым миелоидным лейкозом и миелодиспластическим синдромом высокого риска с FLT3 дикого типа или с мутированным FLT3. J Clin Oncol. 2010. 28: 4339–45.

    CAS PubMed PubMed Central Google ученый

  • 70.

    Stone RM, Mandrekar SJ, Sanford BL, Laumann K, Geyer SM, Bloomfield CD, et al.Добавление мидостаурина к стандартной химиотерапии снижает кумулятивную частоту рецидивов (CIR) в международном проспективном рандомизированном плацебо-контролируемом двойном слепом исследовании (CALGB 10603 / RATIFY [Alliance]) у пациентов с впервые диагностированным острым миелоидным лейкозом (AML) с FLT3. мутации. Кровь. 2017; 130: 2580.

    Google ученый

  • 71.

    Rydapt PI. 2018. https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/207997s000lbl.pdf; По состоянию на 2018 г.

  • 72.

    Novartis Pharmaceuticals Corporation. Novartis получает одобрение FDA на применение Rydapt® при недавно диагностированном остром миелоидном лейкозе с мутацией FLT3 (AML) и трех типах системного мастоцитоза (SM). 2018. https://www.novartis.com/news/media-releases/novartis-receives-fda-approval-rydaptr-newly-diagnposed-flt3-mutated-acute. По состоянию на 2018 г.

  • 73.

    Rydapt SMC. 2017. http://www.ema.europa.eu/docs/en_GB/document_library/EPAR_-_Product_Information/human/004095/WC500237581.pdf. По состоянию на 2018 г.

  • 74.

    Rydapt SMC. 2018. https://www.ema.europa.eu/documents/product-information/rydapt-epar-product-information_en.pdf; По состоянию на 2018 г.

  • 75.

    Дёнер К., Тиде С., Ларсон Р.А., Прайор Т.В., Маркучи Дж., Джонс Д. и др. Прогностическое влияние генотипов NPM1 / FLT3-ITD от рандомизированных пациентов с острым миелоидным лейкозом (ОМЛ), пролеченных в рамках международного исследования RATIFY. Кровь. 2017; 130: 467.

    Google ученый

  • 76.

    Schlenk R, Döhner K, Salih H, Kündgen A, Fiedler W., Salwender H, et al. Мидостаурин в сочетании с интенсивной индукцией и в качестве поддерживающей терапии с одним агентом после консолидационной терапии с трансплантацией аллогенных гемопоэтических стволовых клеток или цитарабином в высоких дозах (NCT01477606). Кровь. 2015; 126: 322.

    Google ученый

  • 77.

    Schlenk RF, Fiedler W., Salih HR, Wulf G, Thol F, Kündgen A, et al. Влияние возраста и дозы мидостаурина на ответ и исход при остром миелоидном лейкозе с FLT3-ITD: промежуточные анализы исследования AMLSG 16-10.Кровь. 2016; 128: 449.

    Google ученый

  • 78.

    Ларсон Р.А., Мандрекар С.Дж., Сэнфорд Б.Л., Лауманн К., Гейер С.М., Блумфилд С.Д. и др. Анализ поддерживающей терапии и исходов пост-мидостаурина в международном проспективном рандомизированном плацебо-контролируемом двойном слепом исследовании (CALGB 10603 / RATIFY [Alliance]) для пациентов с впервые диагностированным острым миелоидным лейкозом (AML) с мутациями FLT3 . Кровь. 2017; 130: 145.

    Google ученый

  • 79.

    Национальные институты здоровья. ClinicalTrials.gov. https://clinicaltrials.gov/. По состоянию на 2018 г.

  • 80.

    Maziarz RT, Patnaik MM, Scott BL, Mohan SR, Deol A, Rowley SD, et al. RADIUS: фаза 2, рандомизированное исследование стандартного лечения (SOC) с мидостаурином или без него для предотвращения рецидива после аллогенной трансплантации гемопоэтических стволовых клеток (alloHSCT) у пациентов (pts) с FLT3 -Itd-мутировавшим острым миелоидным лейкозом (AML) . Кровь. 2016; 128: 2248.

    Google ученый

  • 81.

    Давер Н., Кортес Дж., Раванди Ф., Патель К.П., Бургер Дж. А., Коноплева М. и др. Вторичные мутации как медиаторы устойчивости к таргетной терапии при лейкозах. Кровь. 2015; 125: 3236–45.

    CAS PubMed PubMed Central Google ученый

  • 82.

    Chao Q, Sprankle KG, Grotzfeld RM, Lai AG, Carter TA, Velasco AM, et al. Идентификация N- (5-трет-бутил-изоксазол-3-ил) -N ‘- {4- [7- (2-морфолин-4-илэтокси) имидазо [2,1-b] [1, 3 ] бензотиазол-2-ил] фенил} дигидрохлорид мочевины (AC220), уникальный мощный, селективный и эффективный ингибитор FMS-подобной тирозинкиназы-3 (FLT3).J Med Chem. 2009. 52: 7808–16.

    CAS PubMed Google ученый

  • 83.

    Gunawardane RN, Nepomuceno RR, Rooks AM, Hunt JP, Ricono JM, Belli B, et al. Кратковременное воздействие хизартиниба опосредует стойкое ингибирование передачи сигналов FLT3, в то же время специфически индуцируя апоптоз в лейкозных клетках, активированных FLT3. Mol Cancer Ther. 2013; 12: 438–47.

    CAS PubMed Google ученый

  • 84.

    Альтман Дж. К., Форан Дж. М., Пратц К. В., Трон Д., Кортес Дж. Э., Таллман М. С.. Фаза 1 исследования хизартиниба в сочетании с индукционной и консолидационной химиотерапией у пациентов с впервые диагностированным острым миелоидным лейкозом. Am J Hematol. 2018; 93: 213–21.

    CAS PubMed Google ученый

  • 85.

    Боуэн Д., Рассел Н., Кнаппер С., Миллиган Д., Хантер А. Э., Хваджа А. и др. AC220 (хизартиниб) можно безопасно комбинировать с традиционной химиотерапией у пожилых пациентов с впервые диагностированным острым миелоидным лейкозом: опыт пилотного исследования AML18.Кровь. 2013; 122: 622.

    Google ученый

  • 86.

    Swaminathan M, Kantarjian HM, Daver N, Borthakur G, Ohanian M, Kadia T., et al. Комбинация хизартиниба с азацитидином или цитарабином в низких дозах очень активна у пациентов (пациентов) с миелоидными лейкозами с мутацией FLT3-ITD: промежуточный отчет исследования фазы I / II. Кровь. 2017; 130: 723.

    Google ученый

  • 87.

    Sandmaier BM, Khaled S, Oran B, Gammon G, Trone D, Frankfurt O.Результаты исследования фазы 1 хизартиниба в качестве поддерживающей терапии у пациентов с острым миелоидным лейкозом в стадии ремиссии после трансплантации аллогенных гемопоэтических стволовых клеток. Am J Hematol. 2018; 93: 222–31.

    CAS PubMed Google ученый

  • 88.

    Шах Н.П., Талпаз М., Дейнингер М.В., Мауро М.Дж., Флинн И.В., Биксби Д. и др. Понатиниб у пациентов с рефрактерным острым миелоидным лейкозом: результаты исследования фазы 1. Br J Haematol.2013; 162: 548–52.

    CAS PubMed Google ученый

  • 89.

    Дэвер Н., Поллиа Д.А., Рицциери Д.А., Палмер Дж., Рампал Р.К., Диннер С. и др. Исследование фазы I FLX925, двойного ингибитора FLT3 и CDK4 / 6 у пациентов с рецидивирующим или рефрактерным острым миелоидным лейкозом (AML). Кровь. 2017; 130: 1343.

    Google ученый

  • 90.

    Сато Т., Ян Х, Кнаппер С., Уайт П., Смит Б.Д., Галкин С. и др.Лиганд FLT3 снижает эффективность ингибиторов FLT3 in vitro и in vivo. Кровь. 2011; 117: 3286–93.

    CAS PubMed PubMed Central Google ученый

  • 91.

    Yang X, Sexauer A, Levis M. Опосредованная стромой костного мозга устойчивость к ингибиторам FLT3 в FLT3-ITD AML опосредуется постоянной активацией внеклеточной регулируемой киназы. Br J Haematol. 2014; 164: 61–72.

    CAS PubMed Google ученый

  • 92.

    Пилото О., Райт М., Браун П., Ким К.Т., Левис М., Смолл Д. Длительное воздействие ингибиторов FLT3 приводит к устойчивости через активацию параллельных сигнальных путей. Кровь. 2007; 109: 1643–52.

    CAS PubMed PubMed Central Google ученый

  • 93.

    Traer E, Martinez J, Javidi-Sharifi N, Agarwal A, Dunlap J, English I, et al. FGF2 из микросреды костного мозга способствует устойчивости к ингибиторам FLT3 при остром миелоидном лейкозе.Cancer Res. 2016; 76: 6471–82.

    CAS PubMed PubMed Central Google ученый

  • 94.

    Dutreix C, Munarini F, Lorenzo S, Roesel J, Wang Y. Исследование опосредованных CYP3A4 межлекарственных взаимодействий с мидостаурином у здоровых добровольцев. Cancer Chemother Pharmacol. 2013; 72: 1223–34.

    CAS PubMed PubMed Central Google ученый

  • 95.

    Чанг Й., Эрнандес Д., Гиаур Дж., Левис М.Дж., Джонс Р.Дж.Строма костного мозга защищает от острого миелоидного лейкоза (AML) FLT3 посредством лекарственного метаболизма ингибиторов тирозинкиназы (TKI) FLT3, опосредованного CYP3A4. Кровь. 2017; 130: 2519.

    Google ученый

  • 96.

    Heidel F, Solem FK, Breitenbuecher F, Lipka DB, Kasper S, Thiede MH, et al. Клиническая резистентность к ингибитору киназы PKC412 при остром миелоидном лейкозе за счет мутации Asn-676 в домене тирозинкиназы FLT3. Кровь. 2006; 107: 293–300.

    CAS PubMed Google ученый

  • 97.

    von Bubnoff N, Engh RA, Aberg E, Sanger J, Peschel C., Duyster J. FMS-подобные тирозинкиназы 3-внутренняя тандемная дупликация ингибиторов тирозинкиназы демонстрируют неперекрывающийся профиль мутаций устойчивости in vitro. Cancer Res. 2009; 69: 3032–41.

    Google ученый

  • 98.

    Patnaik MM. Важность мутационного анализа FLT3 при остром миелоидном лейкозе.Лимфома лейка. 2018; 59: 2273–86.

    Google ученый

  • 99.

    Kampa-Schittenhelm KM, Heinrich MC, Akmut F, Döhner H, Döhner K, Schittenhelm MM. Хизартиниб (AC220) является мощным ингибитором тирозинкиназы второго поколения класса III, который демонстрирует отчетливый профиль ингибирования в отношении мутантных изоформ- FLT3, -PDGFRA и -KIT . Молочный рак. 2013; 12:19.

    Google ученый

  • 100.

    Ли Л. Я., Эрнандес Д., Раджкова Т., Смит С. К., Раман Дж. Р., Нгуен Б. и др. Доклинические исследования гильтеритиниба, ингибитора FLT3 нового поколения. Кровь. 2017; 129: 257–60.

    CAS PubMed PubMed Central Google ученый

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Беспроводная интеллектуальная контактная линза для диагностики и терапии диабета

    Abstract

    Интеллектуальная контактная линза может использоваться в качестве отличного интерфейса между человеческим телом и электронным устройством для носимых медицинских приложений.Несмотря на широкие исследования интеллектуальных контактных линз для диагностических приложений, не было сообщений об электрически контролируемой доставке лекарств в сочетании с биометрическим анализом в реальном времени. Здесь мы разработали умные контактные линзы как для непрерывного мониторинга уровня глюкозы, так и для лечения диабетической ретинопатии. Устройство для интеллектуальных контактных линз, построенное на основе биосовместимого полимера, содержит ультратонкие гибкие электрические схемы и микросхему микроконтроллера для электрохимического биодатчика в реальном времени, контролируемой доставки лекарств по запросу, беспроводного управления питанием и передачи данных.На моделях кроликов с диабетом мы могли измерять уровни глюкозы в слезах, чтобы их подтвердить с помощью обычных инвазивных тестов на уровень глюкозы в крови, и запускать высвобождение лекарств из резервуаров для лечения диабетической ретинопатии. Вместе мы успешно продемонстрировали возможность использования умных контактных линз для неинвазивной и непрерывной диагностики диабета и терапии диабетической ретинопатии.

    ВВЕДЕНИЕ

    В последнее время мягкая биоэлектроника была широко исследована, чтобы использовать преимущества присущих ей полимерных свойств и органической электроники для носимых и имплантируемых медицинских устройств ( 1 , 2 ).На основе этого нововведения было разработано множество видов медицинских устройств для диагностических ( 3 ), терапевтических ( 4 ) и тераностических приложений ( 5 ). Носимые устройства успешно применяются для непрерывного мониторинга уровня глюкозы ( 5 ), электрокардиографии ( 6 ), электромиографии ( 7 ), фотоплетизмографии и пульсоксиметрии ( 8 ). Они могут предоставить важную медицинскую информацию для наблюдения за состоянием здоровья и диагностики различных заболеваний.Кроме того, было разработано новаторское полупроводниковое имплантируемое устройство для доставки лекарств для применения в подкожной жидкости ( 9 ) и положило начало разработке имплантируемых систем доставки лекарств по требованию ( 10 ). Комбинируя эти технологии вместе, было разработано множество видов медицинских устройств для тераностических приложений на стыке биологических, наноразмерных и электронных технологий ( 5 , 11 13 ).

    Среди различных носимых устройств здравоохранения интеллектуальные контактные линзы привлекли большое коммерческое внимание для приложений здравоохранения ( 14 , 15 ).Поверхность роговицы уникальным образом представляет собой удобный и неинвазивный интерфейс для физиологических условий человеческого тела. Глаза напрямую связаны с мозгом, печенью, сердцем, легкими и почками и могут служить окном в тело ( 16 ). В этом контексте Sensimed выпустила одобренный Управлением по контролю за продуктами и лекарствами США (FDA) продукт, Triggerfish, для мониторинга внутриглазного давления у пациентов с глаукомой в 2016 году ( 14 , 15 ). Кроме того, Google разработал линзу Google для диагностики пациентов с диабетом в сотрудничестве с Novartis ( 15 ).Эти умные контактные линзы особенно важны, потому что они делают возможным неинвазивный и непрерывный мониторинг глаукомы и диабета, соответственно. Кроме того, были разработаны интеллектуальные носимые сенсорные системы, интегрированные в мягкие контактные линзы, для измерения изменения сопротивления графеновых сенсоров при связывании глюкозы для дистанционного мониторинга диабета ( 17 , 18 ). Однако электрический ток и изменения цвета в датчиках были пропорциональны в логарифмической шкале концентрациям глюкозы, что могло быть недостаточно для измерения реальной концентрации глюкозы для точной диагностики диабета.

    Здесь мы разработали интеллектуальную контактную линзу с дистанционным управлением для неинвазивного мониторинга глюкозы и контролируемой доставки лекарств для лечения диабетической ретинопатии. Многофункциональная интеллектуальная контактная линза состоит из пяти основных частей: электрохимического биосенсора в реальном времени, гибкой системы доставки лекарств по запросу (f-DDS), резонансной индуктивной беспроводной системы передачи энергии, микроконтроллера на базе дополнительной интегральной схемы (IC). микросхема с блоком управления питанием (PMU) и системой удаленной радиочастотной (RF) связи (рис.1). Амперометрический биосенсор в реальном времени предназначен для обнаружения глюкозы в слезах, заменяя необходимость инвазивных анализов крови. Лекарства могут быть выпущены из саморегулируемого пульсирующего f-DDS с помощью удаленной связи. Резонансная индуктивная связь с медной (Cu) катушкой приемника позволяет получать беспроводное питание от внешнего источника питания с катушкой передатчика. Устройство взаимодействует с внешним контроллером посредством радиочастотной связи. Мы оценили и обсудили возможность использования этих умных контактных линз для диагностики диабета и лечения диабетической ретинопатии.

    Рис. 1 Схематическое изображение умных контактных линз для диагностики и лечения диабета.

    В интеллектуальную контактную линзу встроены биосенсор, f-DDS, система беспроводной передачи энергии от катушки передатчика к катушке приемника, микросхема ASIC и система удаленной связи в качестве повсеместной платформы для различных диагностических и терапевтических приложений.

    РЕЗУЛЬТАТЫ

    Получение и характеристика силиконовых гидрогелей для контактных линз

    Были приготовлены силиконовые гидрогели для контактных линз с химической структурой, схематически показанной на рис.S1A. Силикон-гидрогели были изготовлены в виде контактной линзы диаметром 14 мм, толщиной 200 мкм и радиусом кривизны 8,0 мм. Инфракрасная спектроскопия с ослабленным полным отражением с преобразованием Фурье (ATR-FTIR) показала четкие пики, соответствующие химическому присоединению добавленных мономеров (рис. S1B). Длины волн пяти пиков были хорошо согласованы с таковыми у коммерческих силикон-гидрогелевых контактных линз из лотрафилкона А. Контактные силикон-гидрогелевые контактные линзы демонстрировали почти сравнимый коэффициент пропускания с таковым у контактных линз из поли (гидроксиэтилметакрилата) (PHEMA) гидрогеля в качестве контроля в видимый диапазон длин волн (рис.S1C). Равновесное содержание воды (EWC) в контактных линзах из силикон-гидрогеля составляло 33,6%, что было выше, чем у контактных линз из гидрогеля PHEMA (21,3%) и лотрафилкона A (24%) (рис. S1D) из-за высокого соотношения гидрофильные силиконсодержащие мономеры. Диаметр силикон-гидрогелевой линзы увеличился всего на 1-15 мм, тогда как диаметр гидрогелевой линзы PHEMA увеличился на 2-16 мм. Гидрофильность поверхности силикон-гидрогелевой контактной линзы контролировалась обработкой озоновой плазмой.Контактная линза из силикон-гидрогеля с обработанной поверхностью показывала меньший угол контакта с водой, чем контактная линза из гидрогеля PHEMA в каждый момент времени (рис. S1E), и капля воды быстро впитывалась в контактную линзу из силикон-гидрогеля (рис. S1F).

    Электрическое определение концентрации глюкозы в слезе в реальном времени in vitro

    Глазной датчик глюкозы был разработан с тремя электродами, чтобы иметь низкое электрическое сопротивление для облегченной электрохимической реакции глюкозы (рис.2А). Рабочий электрод (WE) и противоэлектрод (CE) были приготовлены из платины (Pt) для эффективной электрохимической реакции. Чтобы улучшить адгезию между полиэтилентерефталатом (ПЭТ) и Pt, слой Cr был нанесен на подложку из ПЭТ в качестве адгезионного слоя перед нанесением слоя Pt. Электрод сравнения (RE), покрытый серебром / хлоридом серебра (Ag / AgCl), повысил точность амперометрического электрохимического датчика глюкозы в жидкой среде, обеспечивая постоянное напряжение на WE во время измерения глюкозы.Чтобы контролировать содержание глюкозы в слезах с высокой чувствительностью и стабильностью, мы покрыли WE смешанным раствором глюкозооксидазы (GOx), бычьего сывороточного альбумина (BSA), поливинилового спирта (PVA) и хитозана. После сушки к сшиванию хитозана и ПВС добавляли глутаральдегид для иммобилизации GOx с BSA. Чтобы подтвердить сильную корреляцию между уровнями глюкозы в крови и слезах, их концентрации у нормальных и диабетических кроликов были измерены до и после трехкратного кормления и голодания.Кролики с диабетом показали более высокие концентрации глюкозы как в слезах, так и в крови, чем у нормальных кроликов (рис. 2В). Эти уровни глюкозы в крови и слезах, по-видимому, находятся в разумном диапазоне, потому что нормальный уровень глюкозы в крови для недиабетиков во время голодания составляет от 70 до 130 мг дл -1 ( 19 ). Из-за большого временного интервала отбора проб мы не смогли наблюдать время задержки в увеличении концентрации глюкозы между кровью и слезой, как описано в другом месте ( 19 ).Однако мы прояснили повторяющуюся сильную корреляцию между уровнем глюкозы в крови и слезой. Эти результаты показали возможность измерения уровня глюкозы в слезах в качестве альтернативы измерению уровня глюкозы в крови для диагностики диабетических заболеваний.

    Рис. 2 Электрическое обнаружение глазных сенсоров глюкозы in vitro.

    ( A ) Схематическое изображение глазного сенсора глюкозы с тремя электродами (WE, рабочий электрод; RE, электрод сравнения; CE, противоэлектрод) и механизм измерения глюкозы в слезах.( B ) Корреляция между уровнями глюкозы в крови и слезах у нормальных и диабетических кроликов. ( C ) Электрическое определение концентраций глюкозы в реальном времени по сравнению с PBS. ( D ) Текущее изменение сенсора глюкозы, показывающее селективность до 0,35 и 0,7 мг дл -1 аскорбиновая кислота (АК), 22,5 и 45 мг дл -1 лактат, 18 и 36 мг дл -1 мочевина и 5 мг дл -1 глюкозы. ( E ) Долгосрочная стабильность сенсора глюкозы после хранения в течение 0, 21, 42 и 63 дней ( n = 3).

    Как показано на рис. 2C, мы могли измерить концентрацию глюкозы в реальном времени по изменению электрического тока in vitro с помощью потенциостата. Ток увеличивался с 0,41 до 3,12 мкА с увеличением концентрации глюкозы с 5 до 50 мг дл -1 . Этот диапазон изменения тока может быть подходящим для удаленного мониторинга физиологического уровня глюкозы. Чтобы оценить избирательность по отношению к глюкозе, мы применили потенциально мешающие молекулы аскорбиновой кислоты (A), лактата (L) и мочевины (U) в слезе (рис.2D). Сообщается, что концентрации ALU составляют около 0,70 мг дл -1 для A ( 20 ), от 18 до 45 мг дл -1 для L ( 21 ) и 36 мг дл -1 для U ( 20 ) в слезу. Когда соответствующие концентрации мешающих молекул (A, L и U) были добавлены в систему измерения глюкозы, наблюдался лишь небольшой шум с незначительным изменением тока. В отличие от A, L и U, добавление 5 мг дл -1 глюкозы быстро увеличивало ток до 0.42 мкА. Кроме того, мы оценили долгосрочную стабильность сенсоров глюкозы (рис. 2E). После изготовления умные контактные линзы хранили в стерилизованном фосфатно-солевом буфере (PBS) при температуре от 20 до 25 ° C, что было аналогично реальной среде хранения контактных линз, в течение 21, 42 и 63 дней. Работа сенсоров глюкозы поддерживалась стабильно с отклонением менее 2% в течение 63 дней ( n = 3).

    Высвобождение f-DDS по требованию

    f-DDS был изготовлен с размерами 1.5 мм на 3 мм на 130 мкм (рис. 3, А и Б). На стеклянную подложку были нанесены отслаивающий слой и буферный слой оксида кремния (SiO 2 ), а резервуар для лекарственного средства был покрыт бездефектным Au анодным электродом. Процесс лазерного отрыва (LLO) с использованием эксимерного лазера локально расплавил и диссоциировал отшелушивающий слой. Буферный слой SiO 2 поддерживал верхний слой устройства во время процесса LLO и блокировал тепловой поток, генерируемый во время лазерного отслаивания.Помимо управления продолжительностью лазерного выстрела, толщина буферного слоя SiO 2 была важным фактором для минимизации теплового повреждения устройства во время процесса LLO. Мы использовали два разных фоторезиста СУ8-5 и СУ8-50. SU8-5 имеет меньшую вязкость и прочность, чем SU8-50. Соответственно, SU8-5 использовался для изоляции электрода, за исключением того, что место высвобождения лекарства для стабильной работы f-DDS и SU8-50 использовалось для создания DDS. Поперечная сканирующая электронная микроскопия (СЭМ) показала электроды и изолированные слои резервуара (рис.S2). Испытание на механический изгиб проводилось для оценки механической надежности f-DDS на гибкой подложке (рис. S3, A и B). Рабочий ток f-DDS поддерживался без каких-либо заметных изменений во время испытания на механическую прочность до 1000 циклов (рис. S3C).

    Рис. 3 Доставка лекарств по запросу с использованием f-DDS.

    ( A ) Схематическое изображение изготовления f-DDS. (i) выращивание буферного слоя диоксида кремния (SiO 2 ) на стеклянной подложке; (ii) нанесение металлов Ti, Au и Ti на анодные и катодные электроды; (iii) формирование паттернов резервуаров лекарственного средства SU8; (iv) загрузка лекарств; (v) прикрепление ПЭТ и лазерного сканирования устройства; (vi) отсоединение f-DDS; и (vii) травление Ti с изоляцией SU8.( B ) Фотография f-DDS. Фото: Бом Хо Мун, KAIST. ( С) СЭМ изображения ф-ДДС до и после испытания золота электрохимии. Масштабная линейка 250 мкм. ( D ) Конфокальные флуоресцентные микроскопические изображения красителя родамина B, высвобождаемого из резервуаров с лекарственным средством. Масштабные линейки 300 мкм (слева) и 500 мкм (справа). ( E ) Текущее изменение f-DDS. ( F ) Выпущенные концентрации генистеина в пульсирующей манере. ( G ) Нормализованное содержание генистеина, выпущенного из резервуаров ( n = 6) по сравнению с исходным содержанием загрузки.

    Загруженные лекарства избирательно высвобождались из резервуара с лекарствами путем включения / выключения управления напряжением. Как показано на СЭМ-изображении Au анодного электрода, тонкая Au мембрана покрывала всю площадь резервуаров с лекарством без какой-либо утечки лекарств (рис. 3C, слева). После приложения электрического напряжения 1,8 В Au-мембрана растворилась в течение 40 с (рис. 3С, справа). Слой Au плавили в PBS при постоянном напряжении в виде AuCl 4 . Конфокальная флуоресцентная микроскопия показала, что красный родаминовый краситель высвобождается из резервуара под действием электрического потенциала (рис.3D). Ток между анодом и катодом увеличился до 6,08 ± 0,16 мкА, а аноды из Au медленно растворялись при небольшом уменьшении тока с 6,08 ± 0,16 мкА до 4,35 ± 0,11 мкА (рис. 3E). Генистеин выпускался пульсирующим образом из трех различных резервуаров с лекарственным средством (рис. 3F). Анод медленно растворялся током в микромасштабе, и лекарство почти полностью высвобождалось после того, как ток был восстановлен до исходного состояния. Мы смогли обнаружить 89,97 ± 37,10% загруженного генистеина в PBS, подтверждая, что терапевтическое количество препарата может высвобождаться из f-DDS (рис.3G). Кроме того, терапевтическое количество метформина для диабетиков могло быть высвобождено из интеллектуальной контактной линзы за счет синхронизированной обратной связи для терапии в месте оказания помощи и других тераностических приложений (рис. S3D).

    Беспроводная передача энергии и дистанционная связь

    Система беспроводной передачи энергии была разработана посредством резонансной индуктивной связи. Катушка приемника, встроенная в интеллектуальную контактную линзу, получает различную электрическую мощность от катушки передатчика в зависимости от расстояния (рис.S4A). Эффективность беспроводной передачи энергии между двумя катушками измерялась анализатором цепей, которая обратно пропорциональна расстоянию (рис. S4A). Требуемая потребляемая мощность PMU, блока считывания датчиков и блока удаленной связи (RCU) на интеллектуальной контактной линзе составляла 43, 34,4 и 2,3 мВт соответственно (рис. S4B). RCU передавал данные со скоростью 445 кбит / с -1 в полосе частот 433 МГц, применяемой для промышленности, науки и медицины (ISM) с использованием двухпозиционной модуляции, и им можно было управлять для отключения для экономии энергии, когда данные были не передается.Используя резонансную индуктивную связь, микросхема специализированной интегральной схемы (ASIC), подключенная к дополнительному конденсатору для хранения энергии, успешно принимала электромагнитную энергию на расстоянии 1 см от катушки передатчика с эффективностью 2%. Эффективности было достаточно для поддержания базовой работы и удаленной связи смарт-контактной линзы. Средний выходной код аналого-цифрового преобразователя (АЦП) из микросхемы ASIC был пропорционален входному току (рис.S5, A и B). Общее преобразование входного сигнала было доступно до 4,1 мкА с разрешаемым входным значением 150 пА, что подходило для электрического определения глюкозы с помощью глазного сенсора глюкозы. Глазной датчик глюкозы и f-DDS работали под управлением микросхемы ASIC путем приложения соответствующих напряжений смещения (рис. S5, B и C). Преобразованные данные биосенсора были сериализованы микросхемой ASIC и успешно переданы на внешнее устройство персонального компьютера (ПК) с использованием беспроводной системы питания и удаленной связи (рис.S5D).

    Изготовление и оценка интегрированной интеллектуальной контактной линзы

    На основе предварительных экспериментальных результатов была изготовлена ​​интеллектуальная контактная линза путем химического сшивания раствора предшественника силиконового гидрогеля, содержащего пленку ПЭТ, в которую был встроен биосенсор глюкозы. , f-DDS, микросхему ASIC, медный приемник энергии и радиочастотные коммуникационные катушки, пассивированные с помощью Parylene C (рис. S6A). Катушка считывающего устройства, которая была подключена к коммерческому усилителю мощности, передавала по беспроводной сети достаточную электрическую мощность на интеллектуальную контактную линзу для определения уровня глюкозы в слезах в реальном времени и дистанционного управления f-DDS (рис.S6B). На RE электрохимического сенсора глюкозы подавали постоянный потенциал, что обеспечивало высокую чувствительность и стабильность. Выходные данные биосенсора передавались по беспроводной сети с помощью удаленной связи с использованием специализированного модуля приемника амплитудной манипуляции (ASK), Alf Vergard Risc (AVR) и ПК. Дистанционно переданные данные показали, что текущее изменение датчика глюкозы было пропорционально применяемому уровню глюкозы in vitro, что подтвердило возможность беспроводного электрического определения глюкозы в реальном времени с помощью интеллектуальной контактной линзы (рис.S6C). Значения изменения выходного тока от 0,40 до 3,13 мкА были аналогичны значениям измерения глюкозы с использованием потенциостата in vitro на рис. 2С. Кроме того, доставка лекарств по запросу была продемонстрирована с помощью дистанционного управления микросхемой ASIC для подачи постоянного напряжения 1,8 В на f-DDS (рис. S6C). Контактные линзы из силикон-гидрогеля с высоким содержанием воды не вызывали каких-либо существенных повреждений биосенсора, f-DDS и других компонентов микронного размера.

    Интеллектуальные контактные линзы для диагностики и лечения in vivo

    Перед применением in vivo безопасность интегрированных интеллектуальных контактных линз оценивали на глазах новозеландских белых кроликов в течение 5 дней (рис.S7). Гистологический анализ извлеченных глаз кроликов с окрашиванием гематоксилином и эозином (H&E) не показал каких-либо заметных повреждений эпителия роговицы, стромы и эндотелия кроликов после ношения умных контактных линз в течение 3 и 5 дней по сравнению с нормальной роговицей кроликов. . Хотя наши умные контактные линзы вызывали некоторую степень отека роговицы, через 5 дней она не вызвала воспалительной реакции. Набухание роговицы, вероятно, было вызвано плохой передачей кислорода через закрытое веко во время сна при ношении контактных линз, что приводит к накоплению молочной кислоты и воды внутри роговицы в результате осмотического сдвига.Никаких инфекций, серьезных побочных реакций или изменений на поверхности глаза при установленном линзе не наблюдалось. В целом, наши результаты продемонстрировали предварительную безопасность смарт-контактных линз при наложении на глаз.

    После этого мы провели оценку интегрированных смарт-контактных линз на глазах кроликов с диабетом для приложений биочувствительности и доставки лекарств, как схематически показано на рис. 4A. Встроенная беспроводная интеллектуальная контактная линза только для определения уровня глюкозы (рис. S8A) или для определения уровня глюкозы и доставки лекарства (рис.S8B) носился на кроличьем глазу и управлялся посредством беспроводной передачи энергии между внешней катушкой передатчика и катушкой приемника на интеллектуальной контактной линзе (рис. S8C). В конечном итоге портативную систему передачи энергии можно установить на смарт-очки или смартфоны, как схематично показано на фиг. 4A. Диабетическим кроликам вводили инсулин, анестезировали кетамином и надевали наши умные контактные линзы (фильм S1). После ношения смарт-контактных линз глазной датчик глюкозы показал повышение концентрации глюкозы до 30.53 мг дл -1 при контакте с глюкозой слезы, а затем снижение до 16,72 мг дл -1 за счет воздействия инсулина на метаболизм глюкозы, что хорошо согласуется с профилем концентрации глюкозы в крови, определенным глюкометром (рис. . 4B). Реальный уровень глюкозы в слезе, измеренный с помощью анализа глюкозы, хорошо согласовывался с преобразованным уровнем глюкозы из значений выходного тока. Группа Парвиза ранее разработала сенсорную систему для контактных линз и выполнила беспроводной мониторинг уровня глюкозы с использованием полидиметилсилоксановой (PDMS) модели глаза ( 20 , 22 ).В то время как выходной ток онлайн-датчика находился в диапазоне от 0 до 400 нА для концентрации глюкозы от 0 до 10,81 мг дл -1 ( 20 ), выходной ток беспроводного датчика находился в диапазоне от 0 до 80 нА для концентрация глюкозы от 0 до 36,03 мг дл -1 ( 22 ). Напротив, мы беспроводным способом измеряем реальный уровень глюкозы в слезе в широком физиологически значимом диапазоне от 0 до 49,9 мг дл -1 in vitro и in vivo с улучшенной чувствительностью (рис.2C и 4B и фиг. S6C).

    Рис. 4. Применение систем интеллектуальных контактных линз in vivo.

    ( A ) Схематическое изображение смарт-контактных линз для диагностики и лечения диабета in vivo. ( B ) Беспроводное измерение уровня глюкозы в слезе в реальном времени in vivo с помощью смарт-контактных линз. Уровни глюкозы в крови и слезах измеряли (i) после инъекции инсулина и анестезии для ношения смарт-контактных линз в PBS. (ii) Уровень глюкозы в слезах увеличился из-за глюкозы в слезах и снизился, отражая снижение уровня глюкозы в крови из-за введенного инсулина.Уровень глюкозы в крови измеряли каждые 5 минут с помощью коммерческого глюкометра. ( C ) Флуоресцентные микроскопические изображения лекарств, абсорбированных в роговице, склере и сетчатке кроликов, носящих интеллектуальные контактные линзы с генистеином (верхний ряд) и без него (нижний ряд). Шкала шкалы 0,1 мм. ( D ) Анализ с помощью инфракрасной камеры для определения температуры глаза, умных контактных линз и передающей катушки после работы в течение 0, 15 и 30 мин.

    Кроме того, мы могли удаленно запускать высвобождение антиангиогенного генистеина из f-DDS на смарт-контактных линзах, прикладывая электрический потенциал по требованию.На рис. 4C показаны изображения флюоресцентной микроскопии криосрезов роговицы, склеры и сетчатки. Генистеин, высвобождаемый смарт-контактной линзой, по-видимому, эффективно доставлялся через роговицу к сетчатке. Слабая флуоресценция в склере показала, что генистеин прошел через склеру с небольшим поглощением. В случае контроля флуоресценция не наблюдалась в криосрезов тканях кроликов, носивших смарт-контактную линзу без генистеина или смарт-контактную линзу с генистеином без электрического запуска для его высвобождения (рис.4C, ниже). На основании результатов мы могли подтвердить возможность использования умных контактных линз для электрически контролируемой доставки терапевтических лекарств в глаза по требованию (таблица 1).

    Таблица 1 Сравнение различных умных контактных линз.

    Инфракрасная тепловизионная камера не показала заметных изменений температуры тела смарт-контактной линзы на глазах кролика (рис. 4D). Вначале температура интеллектуальной контактной линзы составляла 32,4 ° C, поверхности глаза — 34,4 ° C и внешней катушки — 32.0 ° С. После 30 минут работы температура интеллектуальной контактной линзы составила 33,8 ° C с повышением температуры на 1,4 ° C, поверхность глаза — 34,8 ° C с повышением температуры на 0,4 ° C, а температура внешней катушки. составила 29,7 ° C при понижении температуры на 2,3 ° C. Небольшое повышение температуры показало термобезопасность наших умных контактных линз.

    Терапевтический эффект генистеина, высвобождаемого из смарт-контактных линз, на диабетическую ретинопатию

    Новозеландских белых кроликов разделили на пять групп для оценки терапевтического эффекта генистеина, высвобождаемого из смарт-контактных линз, на диабетическую ретинопатию по сравнению с контрольной серией и контрольной группой. группы.В левый глаз кроликов вводили глазные капли PBS для местного применения в качестве отрицательного контроля в группе 1, глазные капли генистеина для местного применения в группе 2, интравитреальную инъекцию генистеина в группе 3 и интравитреальную инъекцию авастина в качестве положительного контроля в группа 4. Правые глаза всех групп обрабатывали умными контактными линзами, содержащими генистеин (которые вместе составляли группу 5). Просвечивающая электронная микроскопия (ПЭМ) визуализировала ингибирующее действие генистеина, высвобождаемого из смарт-контактных линз, на деформацию сосудистой структуры сетчатки (рис.5А). Сосуды сетчатки у диабетиков на рис. 5A (iv) (левый глаз группы 4) и рис. 5A (v) имели круглую форму, окруженную толстыми слоями эндотелиальных клеток сосудов (EC), которые были сопоставимы с таковыми у здорового кролика. ( 23 ). Однако базальная мембрана сосудов выглядела нерегулярной и складчатой ​​без прозрачного сосудистого слоя ЭК на фиг. 5A (i) (левый глаз группы 1), что отражает повышенную проницаемость сосудов и нарушение гемато-ретинального барьера. На Рис. 5A (ii) (левый глаз группы 2) и Рис.5А (iii) (левый глаз группы 3) сосуды имели круглую форму, но окружающие сосудистые слои ЭК не были такими толстыми, как на фиг. 5А (iv и v).

    Рис. 5. Терапевтический эффект in vivo генистеина, высвобождаемого из интеллектуальной контактной линзы.

    Глаза кроликов с диабетом обрабатывали (i) глазными каплями PBS (контроль), (ii) глазными каплями генистеина, (iii) интравитреальной инъекцией генистеина, (iv) интравитреальной инъекцией Авастина и (v) генистеин выпущен из смарт-контактных линз.( A ) Электронные микрофотографии сосудов сетчатки. L — просвет сосуда; ЭК, эндотелиальная клетка; RBC, эритроциты. Масштабная линейка, 1 мкм. ( B ) Флуоресцентные ангиограммы сетчатки (стрелки, сосуды сетчатки). Масштабная линейка 0,2 мм. ( C ) Гистологический анализ повреждения пигментного эпителия сетчатки (RPE) и сосудов сосудистой оболочки (CV) (стрелки, повреждение CV). Шкала шкалы 0,1 мм. ( D ) Обнаружение апоптоза сетчатки с помощью анализа TUNEL. Шкала шкалы 0,1 мм.( E ) Объединенные изображения иммуногистохимического окрашивания для коллагена типа 4 (красный) и PECAM-1 (зеленый) с окрашиванием ядер 4 ‘, 6-диамидино-2-фенилиндолом (синий). Шкала шкалы 0,1 мм. ( F ) Интенсивность флуоресценции неоваскуляризационного поражения хориоидеи сетчатки количественно определена по изображениям (B). ( G ) Интенсивность флуоресценции анализа TUNEL, количественно определенная по изображениям (D). ( H ) Интенсивность иммунохимической флуоресценции (E) коллагена типа 4 (закрашенная рамка), количественно определенная по изображениям на рис.Количественная оценка S9A (красный) и PECAM-1 (пунктирная рамка) по изображениям на рис. S9B (зеленый) [ n = 3, * P <0,05 и ** P <0,01 по сравнению с контрольным образцом (i)].

    На рис. 5В показаны флуоресцентные ангиограммы морфологии сосудов сетчатки. В то время как четкая морфология сосудов не наблюдалась на фиг. 5B (i и ii), сосуды сетчатки (стрелки) с четкой морфологией наблюдались с заметно сниженной проницаемостью сосудов сетчатки на фиг. 5B (iv и v).Флуоресценция наблюдалась по всей паренхиме сетчатки из-за увеличения сосудистой утечки после разрушения гемато-ретинального барьера, как количественно показано на фиг. 5F. На фиг. 5B (iii) наблюдалась небольшая флуоресценция только при скудной сосудистой сети. Результаты гистологического анализа H&E соответствовали результатам ПЭМ-изображений и флуоресцентных ангиограмм (рис. 5C). Кроме того, гибель клеток сетчатки была подтверждена с помощью анализа мечения ник-концов дезоксиуридинтрифосфата, опосредованного терминальной дезоксинуклеотидилтрансферазой (TUNEL), на изображениях поперечных сечений сетчатки (рис.5D). Флуоресценцию теста TUNEL количественно оценивали с помощью программы ImageJ. Когда средняя интенсивность флуоресценции на фиг. 5D (i) была установлена ​​равной 100%, средний процент интенсивности флуоресценции составлял 76,0% на фиг. 5D (ii), 69,0% на фиг. 5D (iii), 37,0% на фиг. . 5D (iv) и 45,1% на фиг. 5D (v) (фиг. 5G). Кроме того, иммуногистохимическое окрашивание на коллаген типа 4 и молекулу адгезии EC тромбоцитов – 1 (PECAM-1) выявило терапевтический эффект генистеина, высвобождаемого из интеллектуальной контактной линзы (рис. 5E). Степень экспрессии коллагена 4 типа и PECAM-1 на рис.S9 (iv и v), чем на рис. S9 (от i до iii) (рис. 5H).

    ОБСУЖДЕНИЕ

    Интеллектуальные электронные контактные линзы широко исследуются для диагностических приложений, особенно для непрерывного мониторинга глюкозы и мониторинга внутриглазного давления. Кроме того, было много сообщений об электрическом и оптическом измерении глюкозы с улучшенной чувствительностью с использованием различных наноматериалов ( 24 26 ). Для повышения чувствительности, стабильности и воспроизводимости мы иммобилизовали GOx в гидрогелях хитозана и ПВС вместе с БСА.PVA, по-видимому, смягчил проблему неравномерного покрытия и растрескивания за счет увеличения вязкости раствора смеси GOx с увеличенным модулем потерь ( 27 ). Также сообщалось, что ПВС оказывает существенное влияние на чувствительность сенсоров глюкозы ( 28 , 29 ). Как показано на рис.2, концентрации глюкозы могут быть точно измерены по изменению электрического тока с помощью нашего сенсора глюкозы, что показывает стабильность для повторного определения уровня глюкозы даже после хранения в течение более 63 дней (рис.2E) и обеспечение непрерывного мониторинга уровня глюкозы в слезе в глазах живых кроликов в реальном времени по сравнению с измерением уровня глюкозы в крови глюкометром (рис. 4B). В отличие от этого, группа Парвиза использовала модельный глаз, а группа Парка сбросила образцы глюкозы непосредственно на глаза кролика после ношения умных контактных линз для оценки их электрохимических сенсоров глюкозы, и нет отчета в научном журнале об обнаружении глюкозы in vivo в Google. линза (таблица 1).

    Несмотря на интенсивные усилия по коммерческому развитию линз Google, они недавно сообщили, что их измерения корреляции между глюкозой в слезе и концентрацией глюкозы в крови недостаточно согласованы, чтобы соответствовать требованиям, предъявляемым к медицинскому устройству.Неутешительные клинические результаты могут быть связаны с проблемами получения надежных показаний уровня глюкозы в слезе в сложной глазной среде. Хотя корреляция между концентрациями глюкозы в слезе и крови остается спорной, есть много отчетов, подтверждающих сильную корреляцию между ними ( 15 , 17 19 ). Как показано на рис. 4В, мы могли выполнять непрерывный мониторинг уровня глюкозы в слезе в реальном времени в глазах живых кроликов, который сильно коррелировал с концентрацией глюкозы в крови.Мы считаем, что при правильной калибровке и базовом мониторинге изменения концентрации глюкозы можно надежно измерить для каждого пациента с помощью умных контактных линз. Это похоже на линзу Triggerfish, одобренную FDA, которая измеряет изменения внутриглазного давления, а не абсолютное внутриглазное давление.

    Кроме того, наши умные контактные линзы обладают уникальной функцией доставки лекарств в глаз. На сегодняшний день разработан ряд контактных линз с лекарственным покрытием с использованием биоразлагаемых полимерных наночастиц и мицелл для повышения эффективности доставки лекарств в глаза.Однако не было сообщений об интеллектуальных контактных линзах с электрически управляемым DDS по требованию, возможно, из-за сложности миниатюризации всех этих электронных компонентов на небольших контактных линзах. Антиангиогенный генистеин и метформин, контролирующий уровень глюкозы, могут доставляться из f-DDS на смарт-контактную линзу (рис. 3 и 4 и рис. S3). Высвободившийся генистеин может быть доставлен через роговицу к сетчатке, как показано на рис. 4, демонстрируя терапевтический эффект при диабетической ретинопатии.Эта интеллектуальная контактная линза для беспроводного биочувствительности и доставки терапевтических лекарств может открыть новые возможности для повсеместного распространения медицинских услуг для дальнейших тераностических применений. Хотя метформин был коммерциализирован как пероральный препарат, его терапевтические эффекты через различные другие пути доставки были хорошо документированы, такие как трансдермальная доставка ( 25 ) и окулярная доставка ( 30 , 31 ). Берштейн ( 31 ) сообщил, что метформин — это не просто пероральный препарат и что он влияет на многие реакции и процессы, такие как пролиферация, апоптоз, ангиогенез и окислительный стресс в клеточных линиях, и, учитывая эти результаты, заявил, что очень разумно применять целевой метформин для местного применения и доставки в глаза.

    Что касается вопроса безопасности смарт-контактных линз, следует тщательно изучить систему беспроводной передачи энергии из-за возможного повреждения глаз из-за тепла, выделяемого смарт-контактными линзами. В этом контексте мы измерили тепло от работы контактной линзы с помощью инфракрасной тепловой камеры, которая не показала заметного изменения температуры в интеллектуальной контактной линзе на глазах кролика (рис. 4D). Единственное небольшое повышение температуры показало термобезопасность наших умных контактных линз.Оптические изображения и гистологический анализ роговицы глаз новозеландских белых кроликов также подтвердили безопасность наших интеллектуальных контактных линз (рис. S7). По всем этим результатам мы можем подтвердить предварительную безопасность наших интеллектуальных контактных линз для дальнейшего использования. Кроме того, одобрение FDA на клиническое использование Triggerfish является важной вспомогательной информацией о безопасности умных контактных линз.

    Таким образом, была успешно разработана интеллектуальная электрохимическая контактная линза с биосенсором глюкозы и f-DDS, управляемым беспроводным питанием и системами удаленной связи как для диагностики, так и для терапии диабета.Мы продемонстрировали биосенсор в реальном времени концентрации глюкозы в слезе и доставку терапевтического препарата генистеина по требованию для лечения диабетической ретинопатии в глазах кроликов с диабетом. Глазной биосенсор глюкозы, равномерно покрытый GOx, иммобилизованным в сшитых гидрогелях хитозана и PVA с BSA, показал высокую чувствительность, линейность и стабильность для повторных применений после длительного хранения в течение 63 дней. Генистеин, доставленный из интеллектуальной контактной линзы через роговицу к сетчатке, показал терапевтический эффект, сравнимый с эффектом интравитреальной инъекции Авастина при диабетической ретинопатии.Эта интеллектуальная тераностическая контактная линза будет изучаться в дальнейшем как носимое устройство следующего поколения для обеспечения биосенсинга глазных биомаркеров в реальном времени и приема лекарств по запросу для повсеместного применения в здравоохранении при различных глазных и других заболеваниях.

    МАТЕРИАЛЫ И МЕТОДЫ

    Приготовление материалов для контактных линз

    Силиконовые гидрогели для контактных линз были приготовлены в атмосфере азота путем фотосшивки 2-гидроэтилметакрилата (HEMA), силиконсодержащих мономеров 3- (триметоксисилил) пропилметакрилата, 3-[триметоксисилил] пропилметакрилата. (триметилсилокси) силил] пропилметакрилат и сшивающий агент диметакрилата этиленгликоля (EGDMA) в течение 15 мин с использованием фотоинициатора Darocur TPO, дифенил (2,4,6-триметилбензоил) фосфиноксида.В качестве контроля гидрогели контактных линз PHEMA получали путем смешивания HEMA и EGDMA с фотоинициатором. Чтобы сформировать форму контактной линзы, раствор предшественника загружали в форму из полипиррола в ультрафиолетовом (УФ) свете с длиной волны 254 нм в течение 8 мин. Контактные линзы из силикона и гидрогеля PHEMA отделяли от формы и обрабатывали поверхность кислородной плазмой (OptiGlow ACE, Glow Research). Подготовленную контактную линзу полностью погружали в PBS при 37 ° C на сутки перед использованием.

    Характеристика материалов контактных линз

    ATR-FTIR (Tensor 27, Bruker) дегидратированных силикон-гидрогелевых контактных линз и лотрафилкона A регистрировали в диапазоне от 400 до 4000 см -1 .Пропускание силиконовых и гидрогелевых контактных линз PHEMA измеряли с использованием спектрометра УФ-видимого света (SD-1000, Scinco) после замачивания в PBS в течение 24 часов. Оба образца помещали в кварцевые пластины и измеряли пропускание в диапазоне длин волн от 250 до 1000 нм. EWC определяли путем взвешивания высушенной контактной линзы ( W, , сухой ) и гидратированной контактной линзы с вымачиванием в PBS в течение 24 часов ( W, , влажный, ). Значение EWC рассчитывали как процент увеличения веса во время гидратации и обезвоживания, используя следующее уравнение: EWC = ( Вт влажный Вт сухой ) / Вт сухой × 100 ( 32 ).Краевые углы контакта с водой на высушенном силиконе и контактных линзах PHEMA измеряли в статическом режиме, капая 5 мкл воды каждые 2 мин (SmartDrop, FemtoFAB).

    Изготовление глазного сенсора глюкозы

    Три WE, CE и RE в сенсоре глюкозы были структурированы хромом (Cr) толщиной 20 нм и Pt толщиной 80 нм на подложке из ПЭТ толщиной 0,23 мкм с использованием электронно-лучевой испаритель. RE дополнительно обрабатывали с образованием слоя серебра (Ag) толщиной 200 нм. Для долговременной стабильности все части сенсора глюкозы, кроме WE, CE и RE, были пассивированы париленом C.Для хлорирования слой Ag погружали в раствор FeCl 3 (1 М, Sigma-Aldrich) на 1 мин. Затем ПВС [2 мас.% (Мас.%), 100000 г моль -1 , Sigma-Aldrich] растворяли в деионизированной воде, а хитозан (0,5 мас.%, Средний молекулярный вес, Sigma-Aldrich) растворяли в уксусной кислоте ( 1 M, Sigma-Aldrich) при интенсивном перемешивании при 80 ° C в течение 12 часов. BSA (10 мг / мл -1 , Sigma-Aldrich) и GOx (50 мг / мл -1 , Sigma-Aldrich) растворяли в 2 мас.% Раствора ПВС, который смешивали с раствором хитозана.Смешанный раствор хранили в эксикаторе для удаления пузырьков. Чтобы равномерно изготовить слой GOx только на WE, все области датчика, кроме WE, были пассивированы PDMS. Затем сенсоры глюкозы обрабатывали УФ-излучением в присутствии озона в течение 10 мин. После удаления PDMS 1,8 мкл приготовленного раствора смеси GOx по каплям наносили на WE и сушили в эксикаторе. Наконец, 1,8 мкл глутарового альдегида (2 мас.%, Sigma-Aldrich) было нанесено по каплям на слой GOx и медленно высушено при 4 ° C.

    Электрическое определение глюкозы in vitro

    Электрические измерения глюкозы in vitro проводились с использованием потенциостата (Ivium Tech.Co., AJ Eindhoven, Нидерланды) и АЦП с компьютерным управлением (6030E, National Instruments). Стакан на 50 мл заполняли 10 мл PBS (1 M, pH 7,4). Датчик глюкозы помещали в химический стакан, чтобы в достаточной степени погрузить чувствительную область в PBS. Датчик глюкозы обнаружил изменение электрического тока при постоянном потенциале 0,7 В по сравнению с Ag / AgCl для стационарных амперометрических откликов на ток. После стабилизации сенсора глюкозы в PBS добавляли раствор глюкозы высокой концентрации (10000 мг дл -1 , Wako) для медленного изменения концентрации глюкозы в химическом стакане с 5 до 50 мг дл -1 , и изменение тока отслеживали для количественного определения глюкозы.Чтобы исследовать селективность и специфичность сенсора глюкозы, изменение тока измеряли после добавления потенциально мешающих молекул, таких как A (0,1 M, Sigma-Aldrich), L (10 M, Sigma-Aldrich) и U (10 M , Sigma-Aldrich) в PBS. Стабильность при длительном хранении и повторное использование сенсора глюкозы оценивали на 0, 21, 42 и 63 дни после изготовления сенсоров глюкозы. Датчики глюкозы хранили при температуре от 20 до 25 ° C в 5 мл стерилизованного PBS (1 M, pH 7,4), аналогично обычным условиям хранения контактных линз.

    Изготовление и характеристика f-DDS

    f-DDS по требованию был подготовлен с помощью процесса LLO. Сначала были выращены эксфолиация гидрированного аморфного кремния (a-Si: H) и буферные слои SiO 2 путем плазменного химического осаждения из газовой фазы. Анодный и катодный электроды f-DDS были покрыты Ti толщиной 10 нм, Au толщиной 80 нм и Ti толщиной 10 нм с помощью электронно-лучевого испарения и литографии. Образцы резервуаров были заполнены негативными фоторезистами толщиной 100 мкм (СУ8-5 и СУ8-50) с размерами 500 мкм на 500 мкм.В качестве модельного лекарственного средства в резервуары загружали 25 нл генистеина (3 M, Sigma-Aldrich) или метформина (2 M) с красителем родамином B (Sigma-Aldrich). Впоследствии резервуары с лекарством закрывали гибкой ПЭТ-пленкой. Эксимерный лазер XeCl экспонировался на задней стороне стеклянной подложки, чтобы отделить резервуар с лекарством SU-8 на пленке ПЭТ от стеклянной подложки. Для испытания на механический изгиб вся f-DDS была изогнута с радиусом изгиба в диапазоне от 5 до 30 мм, а электрический ток был измерен с помощью зондовой станции.Долговечность f-DDS оценивалась путем применения 1000 циклов изгиба при фиксированном радиусе изгиба 5 мм.

    Характеристика f-DDS

    Высвобождение лекарственного средства в ответ на приложенное напряжение исследовали путем соединения анодного и катодного электродов с зондовой станцией. Между анодным и катодным электродами прикладывали постоянный электрический потенциал 1,8 В в течение 1 мин. Родаминовый краситель, высвобожденный из резервуара, визуализировали с помощью конфокальной микроскопии (Leica) с использованием соответствующего программного обеспечения для визуализации (FluoView).Длина волны возбуждения составляла 543 нм, а длина волны излучения находилась в диапазоне от 560 до 610 нм. Концентрацию высвобожденного генистеина и метформина в PBS определяли количественно с помощью спектрофлуориметра (Thermo Fisher Scientific) при длинах волн возбуждения / испускания 355/460 нм и 485/538 нм соответственно.

    Изготовление катушек, передающих энергию

    Для установки в контактную линзу был изготовлен беспроводной приемник энергии, состоящий из медной (Cu) катушки толщиной 0,1 мм и внешним диаметром 1 мм.2 мм. ПДМС наносили методом центрифугирования на стеклянную подложку с прикреплением 0,1 мм медной фольги (Sigma-Aldrich). После полимеризации PDMS в печи при 70 ° C в течение 1 часа на медной фольге был сформирован рисунок с помощью фотолитографии. Фольгу протравливали влажным травлением в 5 мл раствора персульфата аммония (12 мг / мл -1 ) в течение 6 часов и отделяли от PDMS. Затем змеевик для Cu промывали ацетоном, этанолом и дистиллированной водой в течение 10 мин с обработкой ультразвуком соответственно. Катушка для передачи энергии была изготовлена ​​с использованием четырехвиткового медного провода (Sigma-Aldrich) толщиной 1 мм и внешним диаметром 5 см.

    Измерение эффективности передачи энергии

    Система беспроводной передачи энергии состояла из медной катушки передатчика энергии, медной катушки приемника энергии в контактной линзе, функционального генератора (AFG 3101, Tektronix), коммерческого модуля усилителя мощности (MAX 7060) , и микросхему ASIC. Модуль усилителя мощности использовался для подачи достаточной мощности на микросхему ASIC. Катушка передатчика передавала мощность на катушку приемника посредством резонансной индуктивной связи. Катушка приемника, встроенная в контактную линзу, была выровнена параллельно катушке передатчика на расстоянии от 0 до 4 см для измерения ее эффективности.Эффективность беспроводной передачи энергии между двумя катушками измерялась с помощью анализатора цепей (N5230A, Agilent).

    Разработка и изготовление микросхемы ASIC

    Микросхема ASIC изготавливается по индивидуальному заказу путем изготовления нескольких пластин. Микросхема ASIC была изготовлена ​​компанией Taiwan Semiconductor Manufacturing Company с использованием 180-нм процесса комплементарного металл-оксидного полупроводника (CMOS). PMU выпрямлял поступающую энергию переменного тока (ac) из катушки в напряжение питания постоянного тока (dc) и генерировал различные регулируемые напряжения для других подблоков.ПДУ передавал данные посредством двухпозиционной модуляции 433 МГц. Генератор опорных тактовых импульсов (CLK REF ) был реализован с релаксационным генератором для синхронизации системы. Потенциостат с тремя узлами (WE, RE и CE) был интегрирован в микросхему ASIC с помощью соединения Au flip-chip. Потенциостат подавал напряжение смещения 1,2 В на RE и 1,85 В на WE с помощью операционного усилителя с отрицательной обратной связью. За изменением электрического тока следили в режиме реального времени, капая раствор образца глюкозы.Интегрированный АЦП получил входной ток от потенциостата и преобразовал его в 15-битный цифровой выходной код ( 33 ). Затем выходные коды передавались извне через полосу частот ISM 433 МГц с использованием RCU. Характеристики измерения тока ΔΣ-АЦП были измерены путем подачи входного тока от текущего поставщика (B2961A, Agilent). Чтобы подавить влияние сильного шума от оборудования, к измеренным цифровым кодам применялась программная фильтрация. Модуль РЧ-приемника передавал полученные данные в AVR, и AVR обменивался данными с ПК, используя протокол RS-232.Программное обеспечение декодировало пакеты данных и отображало необработанные данные на ПК.

    Управление питанием микросхемы ASIC

    PMU по беспроводной сети получал переменный ток и преобразовывал его в постоянный ток с помощью MOS-выпрямителя, генерируя внешнее выпрямленное напряжение ( В EXT ). Контрольная схема с шириной запрещенной зоны генерировала опорное напряжение 1,2 В, которое было преобразовано с повышением до 1,85 В и буферизовано с помощью регулятора для обеспечения внутреннего напряжения питания ( В INT ), управляющего всеми логическими блоками управления микросхемы ASIC.Для контролируемой доставки лекарственного средства анодные и катодные электроды в f-DDS были подключены к PMU, который избирательно управлял f-DDS в соответствии с командами управления, полученными от внешнего считывающего устройства.

    Система удаленной связи

    RCU состоял из настроенного передатчика индуктивно-конденсаторный (LC) с частотой 433 МГц и его логики управления. Логика управления сериализовала вывод АЦП и исправила предопределенный заголовок, чтобы определить границу пакета. Несущая частота определялась внутренними конденсаторами с внешней рамочной антенной (L).модуляции данных осуществляли путем управления изменением импеданса передатчика LC, что можно было наблюдать с помощью внешнего считывателя. Приемник ASK в считывателе демодулировал изменение импеданса, восстанавливая переданные данные из микросхемы ASIC. Удаленная телеметрия была сформирована с помощью микросхемы ASIC, модуля приемника, AVR (Atmega-128) и программного обеспечения для обработки данных, написанного на Java.

    Общее производство интегрированной интеллектуальной контактной линзы

    Из-за ограничения окулярного поля зрения катушка приемника энергии, биосенсор и f-DDS были изготовлены на периферийной области контактной линзы.Катушка приемника мощности Cu была прикреплена к ультратонкой пленке ПЭТ (25 мкм) с помощью f-DDS с использованием адгезива PDMS. Микросхема ASIC была реализована с помощью стандартного процесса CMOS 0,18 мкм и нарезана кубиками размером 1,5 мм на 1,5 мм на 0,2 мм путем химической полировки и механической резки. После этого нарезанный кубиками микросхема ASIC была прикреплена, и WE, CE и RE биосенсора были нанесены на подложку из ПЭТ. Катушка приемника энергии, электроды биосенсора и f-DDS были электрически связаны с микросхемой ASIC с помощью соединения Au flip-chip.Для изоляции и гидроизоляции все устройства на подложке из ПЭТ были покрыты париленом C и PDMS, за исключением сенсорного канала биосенсора и открытых электродов f-DDS. Наконец, интегрированные устройства были отлиты в силикон-гидрогели для изготовления умных контактных линз.

    Приготовление кроликов с моделями диабетической ретинопатии

    Для мониторинга глюкозы in vivo и лечения диабетической ретинопатии модели кроликов, индуцированных стрептозотоцином (STZ), получали путем однократной инъекции STZ (65 мг · кг -1 ) (1% STZ). раствор, разбавленный 0.1 M цитратный буфер, pH 4,4) новозеландским белым кроликам (2,0 кг) через ушную вену после голодания в течение 12 часов. После инъекции STZ кролики с концентрацией глюкозы в плазме выше 140 мг дл -1 считались диабетиками.

    Электрическое определение уровня глюкозы в слезе in vivo

    Для мониторинга глюкозы в реальном времени in vivo на глаза каждого кролика-диабетика надевали умные контактные линзы, а катушка передатчика энергии была размещена вне глаз для передачи беспроводной мощности на приемник катушка на смарт-контактной линзе.Напряжение подавалось на датчик глюкозы в импульсном режиме, и электрические измерения концентрации глюкозы проводились в режиме реального времени с дистанционной передачей данных. Перед 15-минутным беспроводным измерением уровня глюкозы в слезе было введено 2 ЕД инсулина для снижения уровня глюкозы в крови. Через 5 мин диабетическим кроликам вводили кетамин для обезболивания. PBS наносили на глаза диабетическому кролику, и на глаз надевали интеллектуальную контактную линзу, чтобы начать беспроводной мониторинг уровня глюкозы в слезе.

    Анализ проникновения генистеина in vivo

    Проникновение генистеина, высвобождаемого из интеллектуальных контактных линз, в глаза исследовали после размещения смарт-контактных линз, нагруженных генистеином, на глаза кролика с беспроводным питанием для работы f-DDS. Через 1 час проникновение генистеина было подтверждено флуоресцентным микроскопическим анализом в криосрезов ткани роговицы, склеры и сетчатки с использованием флуоресцентного микроскопа (Fluoroskan Ascent, Thermo Fisher Scientific) при длине волны возбуждения 355 нм и длине волны излучения 460 нм.

    Электронная микроскопия и гистологический анализ

    Для электронного микроскопического анализа кровеносных сосудов сетчатки сетчатку удаляли и фиксировали в 4 мас.% Глутаровом альдегиде и 1 мас.% Растворе четырехокиси осмия. Образцы обезвоживали этанолом и делали срезы для наблюдения поперечного сечения кровеносных сосудов сетчатки с помощью ТЕМ (JEM-1010, JEOL). Гистологический анализ проводили с окрашиванием H&E сетчатки, фиксированной в 4% (мас. / Об.) Параформальдегиде в течение 24 часов.

    Лечение диабетической ретинопатии in vivo

    Лечение диабетической ретинопатии с помощью умных контактных линз проводилось в течение 5 дней на правых глазах кроликов в пяти группах.Электроэнергия передавалась по беспроводной сети на частоте около 433 МГц с использованием катушки передачи энергии для работы f-DDS. В качестве контроля использовали глазные капли PBS (0,05 мл, группа 1), глазные капли генистеина (0,4 мМ, 0,05 мл, группа 2) и интравитреальное введение генистеина (0,4 мМ, 0,05 мл, группа 3). на левых глазах каждого кролика одновременно с обработкой смарт-контактных линз. Кроме того, интравитреальное введение Авастина (0,05 мл, группа 4) выполняли в левый глаз кроликов.Правые глаза всех групп обрабатывали умными контактными линзами, содержащими генистеин (группа 5).

    Иммунофлуоресцентное окрашивание сетчатки целиком

    Глаза кролика помещали в 4% параформальдегид на 45 мин. После фиксации сетчатку рассекали и выравнивали с помощью разрезов, снимающих кривизну. Затем сетчатку фиксировали еще на 1 час. Сетчатку дважды промывали PBS и инкубировали с 0,2% раствором Triton X-100 в PBS при комнатной температуре в течение 1 часа.Наконец, сосуды окрашивали меченным флуоресцеинизотиоцианатом лектином из Bandeiraea simplicifolia (1: 100, Sigma-Aldrich).

    Анализ иммуноокрашивания

    Анализ TUNEL выполняли в соответствии со стандартным протоколом. Иммуноокрашивание коллагена IV типа и PECAM-1 проводили согласно протоколам производителя. Были использованы следующие антитела: антитело PECAM-1 (sc-18916, Santa Cruz Biotechnology) и антитело к коллагену IV типа (ab6586, Abcam). Ядра контрастировали 4 ‘, 6-диамидино-2-фенилиндолом.Изображения сосудистой сети получали при увеличении × 10. Вся интенсивность флуоресценции была определена количественно программой ImageJ.

    Одобрение исследования

    Все эксперименты проводились в соответствии с Положением Ассоциации исследований в области зрения и офтальмологии по использованию животных в офтальмологических исследованиях и исследованиях зрения. Протокол на животных был одобрен Комитетом по институциональному уходу и использованию животных Медицинского колледжа Корейского католического университета.

    Статистический анализ

    Мы провели односторонний статистический анализ с использованием тестов Стьюдента t или одностороннего дисперсионного анализа (ANOVA) с посттестом Бонферрони. P <0,05 считалось статистически значимым. Количественную оценку флуоресцентных изображений выполняли с помощью программы ImageJ. Все точки данных были получены из трех или более биологических или технических повторов, как указано для каждого эксперимента.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution-NonCommercial, которая разрешает использование, распространение и воспроизведение на любом носителе, при условии, что конечным результатом будет использование , а не для коммерческих целей и при условии, что оригинальная работа правильно процитирована.

    Благодарности: Финансирование: Эта работа финансировалась Samsung Science & Technology Foundation (SRFC-IT1401-03) в Корее. Это исследование было поддержано Центром передовой мягкой электроники (Global Frontier Project, CASE-2015M3A6A5072945) и Программой фундаментальных научных исследований (2017R1E1A1A03070458 и 2020R1A2C3014070) Национального исследовательского фонда (NRF), финансируемой Министерством науки и информационных технологий Кореи. . Эта работа также была поддержана проектом World Class 300 Project (S2482887) Управления малого и среднего бизнеса (SMBA), Корея.D.M. был поддержан Национальным институтом глаз (K08EY028176 и P30-EY026877) и Фондом исследований по предотвращению слепоты. Вклад авторов: S.K.H. задумал и руководил проектом, проводил эксперименты, интерпретировал данные и написал рукопись. D.H.K. и С.-К.К. провели эксперименты, собрали образцы, проанализировали и интерпретировали данные и написали рукопись. J.K., C.J., B.H.M., K.J.L., E.K. и S.H.Y. участвовал в разработке и разработке смарт-контактных линз.G.-H.L., S.S., J.-Y.S. и Z.B. участвовал в разработке и проведении электрических экспериментов. J.W.M. и C.J. участвовали в разработке и проведении экспериментов на животных. D.M. способствовал анализу и интерпретации данных и редактированию рукописи. Все авторы внесли свой вклад в критическое прочтение и исправление этой рукописи. Конкурирующие интересы: S.H.Y., E.K., K.J.L., D.H.K., C.-K.J. и S.K.H. являются изобретателями по патенту, связанному с этой работой, поданному Гарвардской медицинской школой и PHI Biomed Co.

    alexxlab

    *

    *

    Top